ID: 1037578094

View in Genome Browser
Species Human (GRCh38)
Location 8:20226705-20226727
Sequence TATCCAGAACAGGCCGGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1227
Summary {0: 1, 1: 2, 2: 20, 3: 165, 4: 1039}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037578094_1037578098 -9 Left 1037578094 8:20226705-20226727 CCGCGCCCGGCCTGTTCTGGATA 0: 1
1: 2
2: 20
3: 165
4: 1039
Right 1037578098 8:20226719-20226741 TTCTGGATATTTCTTATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037578094 Original CRISPR TATCCAGAACAGGCCGGGCG CGG (reversed) Intronic
901093043 1:6655811-6655833 AAACAAGAACAGGCCGGGTGTGG + Intronic
901106419 1:6759814-6759836 TTGCAAGAACAGGCTGGGCGTGG + Intergenic
901107653 1:6769799-6769821 TATACAAAAATGGCCGGGCGCGG + Intergenic
901518613 1:9766366-9766388 TAAACAAAATAGGCCGGGCGCGG + Intronic
901554022 1:10017483-10017505 TATCTTGAGCAGGCCGGTCGCGG - Intergenic
901704933 1:11066469-11066491 AATCCAGAGCCGGCCGGGTGCGG - Intergenic
901826235 1:11863428-11863450 TCTTCGGAACAGGCCGGGCACGG - Intergenic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
902241474 1:15092763-15092785 AAACCTAAACAGGCCGGGCGTGG - Intronic
902345117 1:15810952-15810974 AAACCTGAACAGGCCGGGCCCGG + Intergenic
902444893 1:16456313-16456335 CATCCAAATCAGGCCAGGCGCGG - Intronic
903047872 1:20577849-20577871 TGTGCTGAAGAGGCCGGGCGTGG - Intergenic
903203807 1:21765318-21765340 TAAACAGGACAGACCGGGCGGGG + Intronic
903403509 1:23076679-23076701 TATCCAGGGAAGGCCGAGCGTGG + Intronic
903418777 1:23203187-23203209 TTTCCAGATTTGGCCGGGCGCGG - Intergenic
903799767 1:25957920-25957942 AACCCAAGACAGGCCGGGCGCGG + Intergenic
903931884 1:26866956-26866978 TAAACAAAATAGGCCGGGCGCGG - Intergenic
904068123 1:27771377-27771399 TAACCAAAACAGGCTGGGTGCGG + Intergenic
904098987 1:28006414-28006436 AATCCATAACTAGCCGGGCGCGG + Intronic
904219244 1:28951561-28951583 AATCGAGATCAGGCTGGGCGTGG + Intronic
904708583 1:32411148-32411170 TAAGAAGAACAGGCTGGGCGTGG - Intergenic
904734173 1:32617633-32617655 AGTCCACATCAGGCCGGGCGTGG - Intronic
905209657 1:36365277-36365299 GGGCCAAAACAGGCCGGGCGCGG - Intronic
905611859 1:39359678-39359700 TATCGTATACAGGCCGGGCGTGG + Intronic
905621371 1:39450899-39450921 AATACAGTAAAGGCCGGGCGCGG - Intronic
905687353 1:39918076-39918098 TTTCAAGAACAGGCCAGGAGTGG + Intergenic
905996263 1:42383174-42383196 TAAAAAGAACAGGCCGGACGCGG - Intronic
906014683 1:42564554-42564576 AATCCTGAATAGGCTGGGCGTGG - Intronic
906064567 1:42971156-42971178 TATCCATGTCAGGCCGGGTGGGG + Intergenic
906362609 1:45176553-45176575 AATGTAGACCAGGCCGGGCGCGG - Intronic
906407705 1:45555195-45555217 AATACAGTATAGGCCGGGCGTGG + Intronic
906446245 1:45900753-45900775 TATCCAACATCGGCCGGGCGCGG - Intronic
907352566 1:53844871-53844893 AATCAAGAACTGGCCGGGTGCGG - Intergenic
908506869 1:64812053-64812075 TATTGATAACAGGCCAGGCGCGG + Intronic
909947120 1:81676297-81676319 AAAACAAAACAGGCCGGGCGCGG - Intronic
910290512 1:85596066-85596088 GATGGAGAACAGGCTGGGCGTGG + Intergenic
910294245 1:85628555-85628577 TATTAAGAACTGGCCGGGCATGG - Intergenic
910395926 1:86793911-86793933 TATCCAAATGAGGCCGGGCACGG + Intergenic
911701758 1:100961249-100961271 TACACAAAACAGGCCGGGCGCGG - Intronic
911876525 1:103170623-103170645 AATACATAATAGGCCGGGCGCGG - Intergenic
911951331 1:104177232-104177254 TAACCATAAAAGGACGGGCGCGG + Intergenic
912076114 1:105878468-105878490 TAGTCAGAGCAGGCCGGGCGTGG + Intergenic
912331872 1:108827522-108827544 TATACAAGACAGGCCAGGCGCGG + Intronic
912343897 1:108946017-108946039 TAGCCAGACGTGGCCGGGCGCGG + Intronic
912675564 1:111677082-111677104 AATCTAGAAAAGGCCGGGCACGG - Intronic
912685533 1:111759682-111759704 AATGAAGAGCAGGCCGGGCGCGG + Intronic
912875105 1:113349804-113349826 TACCCAAACTAGGCCGGGCGTGG - Intergenic
912929954 1:113949126-113949148 TAGCGATAACAGGCCAGGCGCGG - Intronic
913330759 1:117665438-117665460 ATTACTGAACAGGCCGGGCGCGG - Intergenic
914394830 1:147255515-147255537 TATGAAAAATAGGCCGGGCGCGG - Intronic
914674201 1:149895846-149895868 TAACCATCACAGGCCGTGCGTGG + Intronic
914706902 1:150177631-150177653 TATGAAGTACTGGCCGGGCGCGG - Intergenic
915143695 1:153782032-153782054 TAACCTGAGCCGGCCGGGCGCGG - Intergenic
915347343 1:155204297-155204319 ACTCGAGACCAGGCCGGGCGCGG + Intronic
915398194 1:155602042-155602064 AAGGCAGAAGAGGCCGGGCGCGG - Intergenic
915705314 1:157838064-157838086 TAGCCAGATTAGGCCAGGCGTGG - Intronic
916040659 1:160958473-160958495 TATCCAGAATTGGCCGGGCTTGG - Intergenic
916102010 1:161400690-161400712 AATTAAGAAGAGGCCGGGCGCGG + Intergenic
916539255 1:165736425-165736447 TTAAGAGAACAGGCCGGGCGCGG + Intronic
917296175 1:173521907-173521929 AATGCAGAAAAGGCCGGGCGCGG + Intronic
917894047 1:179469218-179469240 TGTCCACAACAGGCCAGGTGTGG - Intronic
918348396 1:183627881-183627903 TCTGCAGCATAGGCCGGGCGCGG + Intronic
918371828 1:183868823-183868845 TATCCAGAGCTGGCCGGGCGTGG + Intronic
918426120 1:184411710-184411732 TACCCATAACCGGCTGGGCGCGG - Intronic
918977140 1:191504097-191504119 TATACAGGACCGGCCGGGCGCGG - Intergenic
918985031 1:191614217-191614239 AATGCAGTACAGGCCGGGCGCGG - Intergenic
919365743 1:196658713-196658735 TTACCTGAGCAGGCCGGGCGCGG - Intronic
919676391 1:200387782-200387804 CAGCAAGAACTGGCCGGGCGTGG + Intergenic
919888690 1:201954418-201954440 TATGGGGACCAGGCCGGGCGTGG - Intergenic
920134628 1:203759597-203759619 TATTCAGGACAGGCCTGGCACGG - Intergenic
920140123 1:203804440-203804462 TATACAGGAAGGGCCGGGCGTGG - Intronic
920324199 1:205149056-205149078 AATACAAAATAGGCCGGGCGTGG - Intronic
920331228 1:205210191-205210213 GACCCTGAAGAGGCCGGGCGCGG - Intronic
920782136 1:209004288-209004310 TCACCAGTAGAGGCCGGGCGCGG + Intergenic
920852905 1:209640789-209640811 TACCTAGCACAGGCCAGGCGCGG + Intronic
920923473 1:210319096-210319118 TTTATAGAACAGGCCAGGCGCGG + Intergenic
921015845 1:211190311-211190333 AATACAAAACAGGCCGGGCGCGG + Intergenic
921480200 1:215656022-215656044 TAACTAGCACAGGCCGGGCGCGG - Intronic
922141124 1:222887786-222887808 AAACAAAAACAGGCCGGGCGCGG - Intronic
922433003 1:225574609-225574631 TATAAAAAAAAGGCCGGGCGCGG + Intronic
922474116 1:225895092-225895114 AATCAAGAACGGGCTGGGCGCGG + Intronic
922794222 1:228331939-228331961 ATTACAGAAGAGGCCGGGCGTGG + Intronic
923011163 1:230088825-230088847 TAGACAGAAGTGGCCGGGCGCGG - Intronic
923060360 1:230466556-230466578 TCCTAAGAACAGGCCGGGCGCGG - Intergenic
923168600 1:231391995-231392017 TATAAAGCACAGGCTGGGCGCGG + Intronic
923603114 1:235420769-235420791 TAGCCAGACGAGGCCAGGCGTGG - Intronic
923653573 1:235896493-235896515 ATTACAGAAGAGGCCGGGCGTGG + Intergenic
923703058 1:236318213-236318235 TCTTGAAAACAGGCCGGGCGCGG - Intergenic
924473201 1:244361517-244361539 AATGTAGAACAGGCCGGGCGCGG - Intronic
924532130 1:244902321-244902343 TACACAAAACAGGCCGGGCGCGG - Intergenic
924544657 1:245015418-245015440 TATCCAGAATCTGCCGGGCGCGG + Intronic
924576776 1:245287791-245287813 TAAAGAGATCAGGCCGGGCGCGG - Intronic
924753425 1:246919421-246919443 AATCCTCAAGAGGCCGGGCGTGG + Intronic
924769626 1:247067550-247067572 GCTCCAGCACAGGCCGGGCGCGG + Intronic
1062975057 10:1676987-1677009 TTTCCAGAACAGGCAGGTCAGGG - Intronic
1063244084 10:4200801-4200823 TAGACAAAGCAGGCCGGGCGTGG + Intergenic
1063387829 10:5627305-5627327 AAACAACAACAGGCCGGGCGCGG - Intergenic
1063616368 10:7603871-7603893 TACCCATATCAGGCCGGGCGTGG - Intronic
1064073588 10:12250913-12250935 TAAACAAAACAGGGCGGGCGTGG - Intergenic
1064199040 10:13269309-13269331 TTTAAAGAAAAGGCCGGGCGTGG + Intergenic
1064260797 10:13784696-13784718 TATCCATAATTGGCCAGGCGCGG + Intronic
1064659990 10:17597426-17597448 TATCCATTGCAGGCTGGGCGTGG - Intronic
1064706118 10:18074232-18074254 CATCCATCACAGGCCGGGTGCGG + Intergenic
1064738409 10:18407410-18407432 AAGACAGAACAGGCCGGGCATGG - Intronic
1064885264 10:20104760-20104782 CTTCCAGATCAGGCCGGGTGTGG + Intronic
1064954672 10:20894622-20894644 AAGCCAGAATAGGCCGGGCATGG + Intronic
1065170044 10:23018195-23018217 TCTCCAGAACAGGCCTGGGTGGG - Intronic
1065389133 10:25164284-25164306 TATCCAGAACAGGCCTGGCATGG - Intergenic
1065708168 10:28490093-28490115 TAACTAAAAGAGGCCGGGCGTGG - Intergenic
1066329482 10:34404374-34404396 TATACAGTACTGGCCGGGTGAGG + Intronic
1066345531 10:34581522-34581544 TAACCTAAATAGGCCGGGCGCGG - Intronic
1067361081 10:45579721-45579743 TATCCACACCAGGCCAGGCGTGG + Intronic
1067404773 10:46011563-46011585 TATGCAGACAGGGCCGGGCGTGG - Intronic
1067677980 10:48403167-48403189 AATTCAGAGCAAGCCGGGCGCGG + Intronic
1067934491 10:50597720-50597742 TTCACAGAACTGGCCGGGCGTGG + Intronic
1068710464 10:60127985-60128007 TATGAAGAACTGGCCGGGCGCGG - Intronic
1068845346 10:61665595-61665617 TATCTAGGGAAGGCCGGGCGCGG + Intronic
1069037581 10:63661527-63661549 CATCAAGAAGAGGCCGGGCGTGG + Intergenic
1069252639 10:66289296-66289318 TTTAAAGAACAGGCCAGGCGTGG + Intronic
1069458182 10:68570393-68570415 TATCCGGTACTGGCTGGGCGCGG - Intronic
1069488464 10:68841233-68841255 AATCAAAAACAGGCCGGGCATGG - Intronic
1069526434 10:69176138-69176160 TAGCAAAAGCAGGCCGGGCGCGG + Intergenic
1069996556 10:72345309-72345331 TAGGCAGGACAGGCCGGACGTGG + Intronic
1070270013 10:74944518-74944540 TATGCAAATTAGGCCGGGCGCGG + Intronic
1070412291 10:76153127-76153149 TAGCCAAAAAAGGCCAGGCGTGG - Intronic
1070443189 10:76466503-76466525 TAACCAACACAGGCTGGGCGTGG + Intronic
1070558270 10:77546538-77546560 TTTTCAGAACAGGCCGGCAGTGG - Intronic
1071917589 10:90312622-90312644 TACCCAGAAATGGCCAGGCGCGG - Intergenic
1072260148 10:93662172-93662194 TTATCAGGACAGGCCGGGCGCGG + Intronic
1072670682 10:97426741-97426763 TGTCGGGGACAGGCCGGGCGTGG + Intronic
1072703379 10:97661279-97661301 AATCCAGCAGTGGCCGGGCGCGG - Intronic
1072713377 10:97733059-97733081 TATAAAAATCAGGCCGGGCGCGG - Intergenic
1073246122 10:102091449-102091471 AATCCTGATCGGGCCGGGCGCGG - Intergenic
1073343500 10:102764102-102764124 AATACAGAGAAGGCCGGGCGTGG - Intronic
1073457044 10:103643819-103643841 TCTGCAGACCAGGCCAGGCGCGG + Intronic
1073752431 10:106544170-106544192 TATTAAGAACTGGCCGGGCCTGG + Intergenic
1074642905 10:115408291-115408313 AATGCAAATCAGGCCGGGCGCGG - Intronic
1075037002 10:119077841-119077863 AATTCAGAGGAGGCCGGGCGTGG - Intronic
1075103538 10:119522426-119522448 TAAAAAGAACTGGCCGGGCGCGG + Intronic
1075362096 10:121847779-121847801 AATCGTGAACAGGCCAGGCGTGG + Intronic
1075511634 10:123077270-123077292 AAACAAGAACAGGCTGGGCGAGG - Intergenic
1075514699 10:123099647-123099669 GCTTCAGGACAGGCCGGGCGCGG + Intergenic
1075642823 10:124076997-124077019 TATTAAGAATTGGCCGGGCGCGG - Intronic
1075825552 10:125354677-125354699 TAGCTAGACGAGGCCGGGCGCGG + Intergenic
1075882692 10:125867444-125867466 AATCAAGGACAGGCCGGGTGTGG + Intronic
1076745851 10:132513213-132513235 TATTAAGAATAGGCCGGGCGTGG + Intergenic
1076905621 10:133359311-133359333 AAACCAAATCAGGCCGGGCGCGG + Intergenic
1076910563 10:133386313-133386335 TTTGCAGAAAAGGCCGGGCGTGG - Intronic
1077071970 11:679020-679042 TATAAAAATCAGGCCGGGCGCGG + Intronic
1077402939 11:2367944-2367966 TGGCCAGAAAAGGCCGGGCCTGG + Intergenic
1077647456 11:3938226-3938248 TTTCTCTAACAGGCCGGGCGCGG - Intronic
1078218810 11:9334517-9334539 AAAACAAAACAGGCCGGGCGCGG + Intergenic
1079101556 11:17545041-17545063 TATCCAGAGAAGGCCGGGCGCGG - Intergenic
1079642155 11:22819479-22819501 TAGCCAATGCAGGCCGGGCGCGG + Exonic
1079980279 11:27143841-27143863 TTTCTAATACAGGCCGGGCGCGG + Intergenic
1080139479 11:28898774-28898796 AAGCAAGAAAAGGCCGGGCGTGG + Intergenic
1080437606 11:32260358-32260380 AATGCAGCACTGGCCGGGCGCGG - Intergenic
1080660427 11:34291784-34291806 TAAACATATCAGGCCGGGCGTGG - Intronic
1081362811 11:42201049-42201071 TATCCAGTAAAGGCCAGGTGCGG - Intergenic
1081786754 11:45753095-45753117 AAACCAGCACAGGCCAGGCGCGG + Intergenic
1082097253 11:48141046-48141068 TAATGAGAACAGGCTGGGCGTGG + Intronic
1082875529 11:57984544-57984566 TATCCAGAGCAGGCTGGAAGAGG + Intergenic
1083087654 11:60167536-60167558 AATCAAGAACAGCCTGGGCGTGG + Intergenic
1083338347 11:61941460-61941482 TATAAAGACCAGGCTGGGCGTGG + Intergenic
1083437638 11:62653489-62653511 CATACAGACTAGGCCGGGCGCGG + Intronic
1083465214 11:62841026-62841048 AATACAAAACAGGCCGGGCGCGG + Intronic
1084012755 11:66361842-66361864 TCTCCAGACCAGGCAGGGCCTGG + Intronic
1084128439 11:67116646-67116668 GCTTTAGAACAGGCCGGGCGCGG - Intergenic
1084335024 11:68452207-68452229 AAACCTGAACAGGCCGGGCACGG + Intergenic
1084738153 11:71119289-71119311 TCTCCAGCACTGGCCGGGTGCGG + Intronic
1085097375 11:73772338-73772360 TACCCATATCTGGCCGGGCGCGG - Intergenic
1085442415 11:76576902-76576924 TATGCAGTCCAGGCTGGGCGCGG - Intergenic
1085639739 11:78185880-78185902 TAGGCAGACCTGGCCGGGCGCGG - Intronic
1086014809 11:82154602-82154624 AATCAACAATAGGCCGGGCGCGG - Intergenic
1086082559 11:82920011-82920033 TACCAACAAAAGGCCGGGCGTGG - Intronic
1086213530 11:84349885-84349907 AATCCAGGCTAGGCCGGGCGCGG + Intronic
1086262062 11:84952253-84952275 AAACCAGAACTGGCCGGGCGCGG + Intronic
1086270133 11:85053496-85053518 TAGTGAGTACAGGCCGGGCGTGG + Intronic
1086373572 11:86178279-86178301 GATCCTGATCTGGCCGGGCGTGG + Intergenic
1086440381 11:86823714-86823736 AATTCAGAGCAGGCCGGGCGCGG + Intronic
1086905587 11:92414718-92414740 TCTGAAGAATAGGCCGGGCGTGG + Intronic
1087050943 11:93885785-93885807 AAGCTAGAACTGGCCGGGCGTGG - Intergenic
1087398393 11:97632764-97632786 TATCAAGGACAGGCCAGACGTGG - Intergenic
1088048674 11:105483695-105483717 TATCCAAATCAGGCTGGGTGTGG - Intergenic
1088093031 11:106065294-106065316 GAACAAAAACAGGCCGGGCGCGG - Intronic
1089273955 11:117320772-117320794 TGTCATAAACAGGCCGGGCGCGG - Intronic
1089501591 11:118934958-118934980 GATGCTGAATAGGCCGGGCGCGG + Intronic
1089521104 11:119064219-119064241 AAACAACAACAGGCCGGGCGTGG + Intergenic
1089538818 11:119177370-119177392 TAAACAGCATAGGCCGGGCGTGG - Intronic
1089542488 11:119198098-119198120 TAGCCACAAGAGGCTGGGCGCGG + Intergenic
1090388035 11:126367855-126367877 TATGCATAGCAGGCCGGGTGTGG + Intronic
1091934772 12:4426412-4426434 TAACAAGACCAGGCCGGGCATGG - Intergenic
1092133660 12:6130864-6130886 TAAATAGAATAGGCCGGGCGTGG + Intergenic
1092153226 12:6265580-6265602 TATGAAGAAGCGGCCGGGCGTGG + Intergenic
1092505430 12:9093768-9093790 AAGCCAGGAGAGGCCGGGCGCGG + Intronic
1092603290 12:10090552-10090574 TACCTAGAATTGGCCGGGCGCGG - Intronic
1092736201 12:11585382-11585404 TAGCCAGGCGAGGCCGGGCGCGG + Intergenic
1092818095 12:12328544-12328566 TAACTAGCACAGGCCAGGCGCGG - Exonic
1093060318 12:14595384-14595406 TAACCAGAGATGGCCGGGCGTGG - Intergenic
1093176966 12:15923310-15923332 AAGCAAAAACAGGCCGGGCGCGG - Intronic
1093574328 12:20709589-20709611 AATTGAAAACAGGCCGGGCGCGG + Intronic
1093972820 12:25390823-25390845 TATCCAGTACCAGCCGGGCGCGG + Intergenic
1094818166 12:34206019-34206041 TAGCCAGAGCAGGGCGGGCCAGG + Intergenic
1096060417 12:48693854-48693876 TTTCCAGAAAAGGCCGCTCGGGG + Exonic
1096343347 12:50822872-50822894 TATTAAAAACAGGCCAGGCGAGG - Intergenic
1096383130 12:51175635-51175657 TACTCACAACAGGCTGGGCGCGG - Intergenic
1096661960 12:53131201-53131223 TATCCAGAATAGGCCATGCATGG - Intergenic
1096678780 12:53241391-53241413 AATACAAAACTGGCCGGGCGTGG - Intergenic
1097064269 12:56309258-56309280 TAGCCAGTGCAGGCCGGGCGCGG + Intronic
1097211545 12:57374397-57374419 TGACCAGACCAGGCCGGGCGTGG + Intronic
1097289796 12:57905078-57905100 AGTCCTGGACAGGCCGGGCGCGG - Intergenic
1097362675 12:58674987-58675009 AAGCCAAGACAGGCCGGGCGAGG - Intronic
1097699454 12:62804963-62804985 TAACCAAAATGGGCCGGGCGCGG - Intronic
1097834756 12:64261842-64261864 AATGCAGTACAGGCCGGGCGTGG - Intergenic
1098027561 12:66220808-66220830 AAAGAAGAACAGGCCGGGCGCGG - Intronic
1098366148 12:69705345-69705367 AAACCAGAACCAGCCGGGCGTGG - Intergenic
1098403452 12:70098403-70098425 TCTCCAAAAGTGGCCGGGCGCGG - Intergenic
1098431650 12:70426002-70426024 TGACCTGAACAGGCCAGGCGGGG + Intronic
1098740283 12:74165314-74165336 AAAGCAGAACAGGCCAGGCGCGG - Intergenic
1098796731 12:74898296-74898318 TAGGCAGAACTGGCCGGGCGCGG + Intergenic
1099065809 12:77976963-77976985 AATACAGTACAGGCCGGGTGTGG - Intronic
1099520102 12:83649873-83649895 TACCCCCAAGAGGCCGGGCGTGG - Intergenic
1099932179 12:89087258-89087280 TAACGAAAACAGGCAGGGCGTGG - Intergenic
1100277233 12:93082272-93082294 TATGGAAAGCAGGCCGGGCGCGG + Intergenic
1100545597 12:95599063-95599085 TATAGGGAAGAGGCCGGGCGCGG - Intergenic
1100646669 12:96539045-96539067 AAACCTGAAAAGGCCGGGCGTGG - Intronic
1100845790 12:98656071-98656093 TAGCCAGGCAAGGCCGGGCGCGG - Intronic
1101379673 12:104203910-104203932 TATACAAAAGAGGCCGAGCGTGG - Intergenic
1101438196 12:104682121-104682143 AAACCAAAACAGGCCAGGCGCGG - Intronic
1101678714 12:106943591-106943613 AAACCAGAGCAGGCCGGGCGCGG - Intergenic
1102086618 12:110146100-110146122 TAGCCAGATTAGGCCGGGCACGG - Intronic
1102096147 12:110242984-110243006 TATGCATAATAGGCCAGGCGTGG - Intergenic
1102130659 12:110526124-110526146 AATCCACAGCAGGCCAGGCGGGG - Intronic
1102256558 12:111418661-111418683 TGGCCAGGCCAGGCCGGGCGGGG - Exonic
1102510039 12:113409046-113409068 AATCCAAAACAGGCTGGGTGCGG + Intronic
1102829079 12:115978615-115978637 TTTACAGTTCAGGCCGGGCGCGG - Intronic
1102835940 12:116060285-116060307 TCACAAAAACAGGCCGGGCGTGG + Intronic
1103317794 12:120071018-120071040 TATACCAACCAGGCCGGGCGTGG - Intronic
1103324829 12:120113526-120113548 AATACAGAACTGGCCGGGCGCGG + Intronic
1103600101 12:122049389-122049411 TATGCTGGAGAGGCCGGGCGTGG + Intronic
1103641001 12:122352345-122352367 AGTCCATAACAGGCCGGGTGCGG - Intronic
1103647952 12:122409820-122409842 AATCCAAATGAGGCCGGGCGCGG - Intronic
1103651952 12:122439861-122439883 AAACAAAAACAGGCCGGGCGCGG + Intergenic
1103725158 12:122994161-122994183 AATGCAGAGCTGGCCGGGCGCGG - Intronic
1103750375 12:123154862-123154884 TACCAAGAATAGGCCGGGTGTGG + Exonic
1103766565 12:123284349-123284371 AAACAAGAATAGGCCGGGCGCGG - Intergenic
1103786018 12:123433700-123433722 TATACAAACCAGGCCAGGCGCGG - Intronic
1104095551 12:125554131-125554153 TATCAACAGTAGGCCGGGCGCGG + Intronic
1104452720 12:128884133-128884155 TATTCAAAACAGGCAGGACGGGG + Intronic
1104455543 12:128908657-128908679 TAAACACGACAGGCCGGGCGCGG + Intronic
1105366890 13:19773526-19773548 TATAAAAAACAGGCCGGGTGCGG - Intronic
1105568605 13:21577515-21577537 TACCCAGATGAGGCTGGGCGTGG + Intronic
1105684285 13:22762946-22762968 AAACCAAAACTGGCCGGGCGCGG - Intergenic
1105742492 13:23342075-23342097 TTTCCAGTACTGGCCGGGCGTGG - Intronic
1105827698 13:24137118-24137140 AATAAAGAACAGGCCGGGCGCGG - Intronic
1105848132 13:24310439-24310461 GATCCATCATAGGCCGGGCGTGG - Intronic
1105902263 13:24765303-24765325 TAACTTGAACCGGCCGGGCGCGG - Intronic
1105950436 13:25225034-25225056 AAACAAAAACAGGCCGGGCGCGG + Intergenic
1106464781 13:30003387-30003409 TATACATAACAGGCTGGGTGCGG - Intergenic
1106506210 13:30372839-30372861 TATGCTGTAGAGGCCGGGCGCGG + Intergenic
1106544709 13:30720148-30720170 TATCCTCTAGAGGCCGGGCGCGG - Intronic
1106580653 13:31015620-31015642 AAACGAGAAAAGGCCGGGCGCGG + Intergenic
1106780979 13:33058628-33058650 AATACAGGACAGGCCGGGCATGG - Intronic
1107550747 13:41472637-41472659 AATGCAAAATAGGCCGGGCGTGG - Intergenic
1107976013 13:45689369-45689391 GATACAGTTCAGGCCGGGCGCGG + Intergenic
1108129227 13:47279377-47279399 AAGCCAGGACAGGCCGGGCGTGG - Intergenic
1108413881 13:50177948-50177970 TAACCAGACAAGGCCGGGGGTGG + Intronic
1109231051 13:59757688-59757710 GACCCATAATAGGCCGGGCGCGG - Intronic
1110050171 13:70887079-70887101 TATGCTAAATAGGCCGGGCGCGG + Intergenic
1110208297 13:72944154-72944176 TATTCAGAATAAGCCGGGTGTGG + Intronic
1110601337 13:77377849-77377871 TATAAAGCAGAGGCCGGGCGCGG - Intergenic
1110731744 13:78886663-78886685 TTACCAGGACAGGCCTGGCGCGG + Intergenic
1110948514 13:81455433-81455455 AATGCAAAACAGGCCGGGCGTGG + Intergenic
1111109925 13:83693717-83693739 AATACAAAACAGGCTGGGCGTGG - Intergenic
1112070419 13:95844250-95844272 TCGCCAAAACAGGCCAGGCGTGG - Intronic
1112104715 13:96228554-96228576 TATTCATGACAGGCCGGGCACGG - Intronic
1113009581 13:105748403-105748425 TCTCCAGCAGTGGCCGGGCGCGG - Intergenic
1113111052 13:106823958-106823980 CATGAAGAAGAGGCCGGGCGCGG - Intergenic
1113196901 13:107818580-107818602 AATCCAGTTGAGGCCGGGCGCGG + Intronic
1113461480 13:110485231-110485253 TTTGCAGCACTGGCCGGGCGCGG + Intronic
1113480059 13:110614198-110614220 TATTATGAAGAGGCCGGGCGTGG - Intergenic
1113535130 13:111060224-111060246 TAGCAAGAACAGGCCAGGTGTGG + Intergenic
1113607798 13:111622670-111622692 AAACCAACACAGGCCGGGCGCGG + Intronic
1114181013 14:20367897-20367919 TACCCAGAGGAGGCCGGGCATGG - Exonic
1114218374 14:20674694-20674716 TATCCAGGTGAGGCTGGGCGTGG - Intergenic
1114428567 14:22640809-22640831 TATCAAGAAGAGGCTGGGTGTGG - Intergenic
1114554440 14:23553602-23553624 AACCAAAAACAGGCCGGGCGTGG + Intronic
1114753506 14:25231902-25231924 TATTCAGCAAAGGCCAGGCGCGG - Intergenic
1115110521 14:29815927-29815949 TAGTCATATCAGGCCGGGCGCGG + Intronic
1115219455 14:31045190-31045212 TATAGACAACAGGCTGGGCGTGG - Intronic
1115595788 14:34907983-34908005 GATAAAGAACAGGCCGGGCACGG + Intergenic
1115619283 14:35125149-35125171 TAGACAGAATAGGCCGGACGCGG - Intronic
1116958747 14:50948876-50948898 AGTACAAAACAGGCCGGGCGCGG - Intergenic
1117005027 14:51412559-51412581 TAACACGGACAGGCCGGGCGCGG + Intergenic
1117099596 14:52332986-52333008 AACACAGAAGAGGCCGGGCGCGG - Intergenic
1117255863 14:53976763-53976785 TATTCAGAACTGGCTGGGCGCGG + Intergenic
1118106508 14:62666127-62666149 AATCCAGGACAGGCCAGGTGTGG + Intergenic
1118555166 14:67010258-67010280 AATCAAGAATAGGCCGGGCGCGG + Intronic
1118813152 14:69290027-69290049 AACTCAGAACAGGCCAGGCGTGG - Intronic
1118834057 14:69463518-69463540 AAAACAGATCAGGCCGGGCGTGG - Intergenic
1119036462 14:71233786-71233808 TATGAATAACAGGCCGGGTGTGG + Intergenic
1119300936 14:73570612-73570634 AAAACAAAACAGGCCGGGCGCGG + Intronic
1119513667 14:75231158-75231180 GCTCCTGAATAGGCCGGGCGCGG - Intergenic
1119875321 14:78054415-78054437 TACCTGGAACAGGCCGGGCGCGG - Intergenic
1120267005 14:82263973-82263995 TAAAGACAACAGGCCGGGCGCGG + Intergenic
1121000155 14:90445963-90445985 TACCTAGAAGAGGCCGGGCATGG - Intergenic
1121209202 14:92194634-92194656 TAATCAGTACAGGCCGGGCACGG + Intergenic
1121386390 14:93530617-93530639 AAACAAAAACAGGCCGGGCGCGG + Intronic
1121426381 14:93855076-93855098 AATACAGAACTGGCCGGGTGTGG + Intergenic
1121450250 14:94002442-94002464 GATACAGAACAGGCCAGGTGTGG - Intergenic
1121855077 14:97261123-97261145 AATAAATAACAGGCCGGGCGCGG + Intergenic
1122051816 14:99066014-99066036 AAGCCAGAAAAGGCCAGGCGAGG + Intergenic
1122217691 14:100214663-100214685 GATCCAGCACAGCCGGGGCGGGG - Intergenic
1122589008 14:102832381-102832403 TATCAAGCACTGGCCGGGCGTGG + Intronic
1122670208 14:103366005-103366027 AATAAAAAACAGGCCGGGCGCGG + Intergenic
1122747197 14:103905395-103905417 AAACCAGAATAGGCCGGGGGCGG + Intergenic
1122749518 14:103922215-103922237 TATGCAGAGCAGGCCGGGCGCGG - Intronic
1123628254 15:22242564-22242586 AACCCAGACCAGGCCGGGCGTGG - Intergenic
1123737137 15:23196222-23196244 TACCCTGTGCAGGCCGGGCGCGG - Intergenic
1124042126 15:26115221-26115243 TATCTATAATAGGCCAGGCGCGG - Intergenic
1124082594 15:26515797-26515819 TACCCAGCACAGGCCGGGCGCGG + Intergenic
1124107728 15:26756277-26756299 TATACAGAACAGGCTGGGCATGG + Intronic
1124288353 15:28424887-28424909 TACCCTGTGCAGGCCGGGCGCGG - Intergenic
1124294871 15:28492427-28492449 TACCCTGTGCAGGCCGGGCGCGG + Intergenic
1124379660 15:29154990-29155012 TAGGCAGAACCGGCCGGGCGTGG + Intronic
1124565742 15:30811789-30811811 TTTAAAGAACAGGCCGGGCACGG - Intergenic
1124596797 15:31098143-31098165 AATACACATCAGGCCGGGCGTGG + Intronic
1125138160 15:36368592-36368614 GAATCAGCACAGGCCGGGCGCGG + Intergenic
1125642611 15:41243908-41243930 TCAGCAGAACAGGCTGGGCGCGG + Intronic
1125662648 15:41406255-41406277 CAACAAAAACAGGCCGGGCGCGG - Intergenic
1125829339 15:42702490-42702512 TAATAACAACAGGCCGGGCGCGG - Intronic
1125847862 15:42874695-42874717 GTTCCAGAAGTGGCCGGGCGCGG + Intronic
1126009878 15:44292484-44292506 TATACAGAACTAGCCGGGTGCGG - Intronic
1126159398 15:45596089-45596111 AACTCAGAATAGGCCGGGCGTGG - Intronic
1126718985 15:51556051-51556073 TCAGCAGATCAGGCCGGGCGCGG + Intronic
1126761665 15:51975250-51975272 AATACTCAACAGGCCGGGCGCGG + Intronic
1127555051 15:60079813-60079835 CACTCAGAAGAGGCCGGGCGCGG + Intergenic
1127560782 15:60134084-60134106 AATCCAGAAAATGCCGGGCACGG + Intergenic
1127699499 15:61484266-61484288 AATGTAGAATAGGCCGGGCGCGG - Intergenic
1127941006 15:63695676-63695698 TATACAGACTCGGCCGGGCGTGG - Intronic
1127982831 15:64046741-64046763 TTTCCAGATAAGGCCGGGGGAGG - Intronic
1128021433 15:64394313-64394335 TATCACAAAAAGGCCGGGCGTGG + Intronic
1128045542 15:64614521-64614543 AATACAGAAAAGGCCAGGCGCGG - Intronic
1128101663 15:65005896-65005918 TTACAAGAACAGGCCAGGCGCGG - Intronic
1128277492 15:66365833-66365855 TATGCAGAGCAGGCTGGGCGCGG - Intronic
1129150032 15:73682875-73682897 TATACACACCCGGCCGGGCGCGG + Intergenic
1129349713 15:74948380-74948402 AACCCAGAGGAGGCCGGGCGCGG + Intergenic
1129446181 15:75620037-75620059 TATACATAAGAGGCCGGGCATGG - Intronic
1129536853 15:76320304-76320326 TGTCCATAGCAGGCTGGGCGTGG + Intergenic
1129673308 15:77618883-77618905 TAAGAATAACAGGCCGGGCGCGG - Intronic
1129691731 15:77717715-77717737 TGTGCAGAACAGCCCGGGCCTGG - Intronic
1129849838 15:78787367-78787389 ACACCAGAACAGGCCGGGCATGG + Intronic
1129873718 15:78958462-78958484 ATTCTAGAGCAGGCCGGGCGTGG - Intergenic
1130027785 15:80284762-80284784 TAGGGAAAACAGGCCGGGCGAGG - Intergenic
1130318230 15:82815058-82815080 TATGAAAAACAGGCCGGGTGCGG - Intronic
1130385002 15:83403488-83403510 TATCCAGCCCAGGCCAGGCGCGG + Intergenic
1130392821 15:83473835-83473857 AAGCCCCAACAGGCCGGGCGCGG - Intronic
1131120092 15:89816843-89816865 TAGCCTGAAGAGGCTGGGCGTGG + Intergenic
1131169644 15:90168406-90168428 TACGCAAAACAGGCTGGGCGTGG - Intronic
1131201228 15:90397804-90397826 TATTGAGTTCAGGCCGGGCGTGG - Intronic
1131563352 15:93463196-93463218 TATTCAGAGCTGGCCGGGCGTGG + Intergenic
1131578093 15:93612348-93612370 AATCCATAATTGGCCGGGCGCGG - Intergenic
1131730545 15:95275468-95275490 CAGGCAGAATAGGCCGGGCGTGG + Intergenic
1132136153 15:99341380-99341402 ACAGCAGAACAGGCCGGGCGCGG - Intronic
1132487094 16:199479-199501 GATCAAGACCAGGCCAGGCGCGG + Intronic
1132520576 16:385912-385934 TATTCAGAGTAGGCCGGGCGCGG - Intronic
1132732272 16:1368310-1368332 TAAAAAAAACAGGCCGGGCGCGG + Intronic
1132818747 16:1850286-1850308 TAAAAATAACAGGCCGGGCGTGG + Intronic
1132894520 16:2222225-2222247 AAACAAAAACAGGCCGGGCGCGG + Intergenic
1132895825 16:2228948-2228970 TATCCAGCCCAAGCTGGGCGTGG - Intronic
1132943969 16:2522072-2522094 TAACAAAAACTGGCCGGGCGCGG - Intronic
1133010237 16:2906452-2906474 AATCCAAAACTAGCCGGGCGTGG + Intergenic
1133032729 16:3019184-3019206 AAAACAAAACAGGCCGGGCGCGG - Intronic
1133129760 16:3669542-3669564 ATTTCAGAACAGGCCAGGCGCGG + Intronic
1133201881 16:4208799-4208821 TATCTAAAACAGGCCGGGCCTGG + Intronic
1133372317 16:5254667-5254689 AATCCAGAACAAGCTGGGTGGGG - Intergenic
1133538554 16:6725339-6725361 TAGCCAAAACCGGCCGGGCGCGG - Intronic
1133788322 16:8989886-8989908 GTTCCAGACCAGGCCGGACGCGG + Intergenic
1133999776 16:10773859-10773881 TCTCCAAAATAGACCGGGCGTGG - Intronic
1134048029 16:11115661-11115683 TACTTAAAACAGGCCGGGCGTGG - Intronic
1134272807 16:12748593-12748615 TATGCAAGACTGGCCGGGCGCGG + Intronic
1134507118 16:14817005-14817027 TATATATATCAGGCCGGGCGCGG - Intronic
1134542531 16:15079098-15079120 TATGAAGAGGAGGCCGGGCGTGG - Intronic
1134694818 16:16215762-16215784 TATATATATCAGGCCGGGCGCGG - Intronic
1134911088 16:18026963-18026985 TAACCAGAGTAGGCCGGGAGCGG - Intergenic
1135097521 16:19576995-19577017 TGTCCATAACAAGCTGGGCGTGG - Intronic
1135573420 16:23566660-23566682 TATCCAAGAAAGGCCAGGCGCGG - Intronic
1136127824 16:28197624-28197646 TATTCAGACTAGGCCGGGCGCGG + Intronic
1136181184 16:28553564-28553586 AATTAAAAACAGGCCGGGCGCGG - Intergenic
1136457344 16:30388262-30388284 TGTAGAGAACAGGCCTGGCGTGG - Intronic
1136532704 16:30880407-30880429 AAGTCAGAACAGGCTGGGCGCGG + Intronic
1136640479 16:31560504-31560526 AAGTCAAAACAGGCCGGGCGCGG + Intergenic
1137290043 16:47046303-47046325 TTTCAAGAATAGGCCGGGAGCGG + Intergenic
1137873238 16:51970815-51970837 AAGCCAGCTCAGGCCGGGCGCGG - Intergenic
1137964371 16:52916086-52916108 TATGCAGATTAGGCCGGGAGCGG - Intergenic
1138393647 16:56688304-56688326 AAACAAAAACAGGCCGGGCGCGG + Intronic
1139250027 16:65486406-65486428 TAAACTGAACTGGCCGGGCGCGG - Intergenic
1139520390 16:67479501-67479523 TCTGCAGTACAGGCCAGGCGCGG - Intronic
1139525178 16:67511258-67511280 TAGCCAGAAGTGGCCAGGCGCGG - Intergenic
1139577891 16:67853935-67853957 CATGCACAACAGGCCAGGCGTGG - Intronic
1139740279 16:69029815-69029837 TAAGAAGAACAGGCCGGGTGTGG + Intronic
1139780687 16:69348903-69348925 GATCTTGAACAGGCTGGGCGTGG - Intronic
1139818279 16:69695551-69695573 AATACAGACCAGGCCGGGCGTGG + Intronic
1140509578 16:75497173-75497195 AATCATGAACAGGCCGGGCACGG - Intergenic
1140813783 16:78602520-78602542 TATCGAGAAGAGGCCGGGTGTGG - Intronic
1141183490 16:81770766-81770788 GGCCCAGATCAGGCCGGGCGCGG + Intronic
1141532936 16:84659291-84659313 TAAACAGAAGAGGCTGGGCGCGG - Intronic
1141718376 16:85740410-85740432 TATCCAGGTGTGGCCGGGCGCGG + Intronic
1141824626 16:86470465-86470487 TATGAAGATCAGGCCAGGCGTGG + Intergenic
1141974359 16:87505102-87505124 AAGCCAGAACAGGCCGGGCATGG - Intergenic
1141975691 16:87514760-87514782 AACCCAGACCAGGCCGGGCGTGG + Intergenic
1141985647 16:87577959-87577981 TCTCAAAAATAGGCCGGGCGCGG + Intergenic
1142192482 16:88724238-88724260 AAAACAGAACAGGCCGGGCACGG + Intronic
1142611736 17:1112176-1112198 TACCCAGAAAAGGCCTGGCATGG + Intronic
1142624387 17:1182654-1182676 GAGCATGAACAGGCCGGGCGCGG - Intronic
1142659486 17:1417947-1417969 AAAACAGAGCAGGCCGGGCGCGG - Intergenic
1142688443 17:1591152-1591174 TCTGCAGAACAGGGCGGGCGGGG + Intronic
1142820750 17:2465251-2465273 AAGACAGATCAGGCCGGGCGCGG + Intronic
1142873025 17:2833425-2833447 TACCAAGAACAGGCCAGGCGCGG - Intronic
1142918262 17:3161605-3161627 TAACGAGAAAAGGCCGGGCGCGG - Intergenic
1143000575 17:3792405-3792427 TATAGATATCAGGCCGGGCGCGG - Intronic
1143068006 17:4264913-4264935 AGTCCAGGACAGGCCGGGCGTGG + Intergenic
1143129487 17:4668103-4668125 TATTGAAAACAGGCTGGGCGCGG + Intergenic
1143193045 17:5054530-5054552 TATGTAGTACGGGCCGGGCGTGG + Intergenic
1143308186 17:5965605-5965627 GATCAGGAACAGGCCAGGCGCGG - Intronic
1143493854 17:7299521-7299543 AATAAAAAACAGGCCGGGCGTGG + Intergenic
1143762995 17:9118227-9118249 TATACAGTTCAGGCCGGGCGCGG + Intronic
1144087832 17:11826750-11826772 CATACAGAACTGGCTGGGCGCGG - Intronic
1144476388 17:15592812-15592834 GAGTCAAAACAGGCCGGGCGCGG + Intronic
1144701099 17:17340812-17340834 AAACAAGAGCAGGCCGGGCGCGG - Intronic
1144921870 17:18770590-18770612 GAGTCAAAACAGGCCGGGCGTGG - Intronic
1146314415 17:31795901-31795923 TAACCAGGAGAGGCCGGGCATGG + Intergenic
1146374113 17:32282910-32282932 TCTCCACAGAAGGCCGGGCGCGG - Intronic
1146444993 17:32926677-32926699 TGACAAGAACAGGCCGGGTGCGG + Intergenic
1146852808 17:36238099-36238121 TATCTAATACAGGCCGGGCACGG + Intronic
1146868718 17:36361991-36362013 TATCTAATACAGGCCAGGCGCGG + Intronic
1147071593 17:37962615-37962637 TATCTAATACAGGCCGGGCGCGG + Intergenic
1147083119 17:38042139-38042161 TATCTAATACAGGCCGGGCGCGG + Intronic
1147099062 17:38166112-38166134 TATCTAATACAGGCCGGGCGCGG + Intergenic
1147232026 17:39026585-39026607 CTTCCTGCACAGGCCGGGCGCGG - Intergenic
1147379199 17:40043224-40043246 TATTAACAACAGGCCGGGTGTGG - Intronic
1147379665 17:40046453-40046475 TAAGAAGAAAAGGCCGGGCGCGG + Intronic
1147395393 17:40138902-40138924 TACTCAGGAAAGGCCGGGCGCGG + Intergenic
1147806838 17:43137894-43137916 AACCCAAAATAGGCCGGGCGCGG + Intergenic
1148127478 17:45244266-45244288 TATCCAGAACAGGCAAGGGTGGG - Intronic
1148444673 17:47730409-47730431 TTTAGAAAACAGGCCGGGCGTGG - Intergenic
1148588071 17:48795035-48795057 ATTCAAGAATAGGCCGGGCGCGG + Intronic
1148696322 17:49561790-49561812 TTTCCATTTCAGGCCGGGCGCGG + Intergenic
1148831642 17:50436417-50436439 TAACAACAACAGGCCGGGCGTGG - Intronic
1148878046 17:50704222-50704244 AATCTACAAGAGGCCGGGCGCGG + Intronic
1149302375 17:55317255-55317277 TACACAAAAAAGGCCGGGCGCGG - Intronic
1149488142 17:57060779-57060801 GATCAAGCATAGGCCGGGCGCGG - Intergenic
1149586923 17:57796074-57796096 TTACAAAAACAGGCCGGGCGTGG + Intergenic
1149743821 17:59075271-59075293 TATACAGAGAAGGCCGGGCACGG + Intronic
1149761340 17:59233221-59233243 AAAACAAAACAGGCCGGGCGCGG + Intronic
1149789366 17:59463870-59463892 TATCCCAAAGAAGCCGGGCGCGG + Intergenic
1149983102 17:61327013-61327035 AAAACAAAACAGGCCGGGCGCGG + Intronic
1150080599 17:62235155-62235177 TATCTAATACAGGCCGGGCGCGG + Intergenic
1150080693 17:62235821-62235843 TAAAATGAACAGGCCGGGCGCGG + Intergenic
1150106478 17:62466034-62466056 TATCTAATACAGGCCAGGCGTGG - Intronic
1150496070 17:65608710-65608732 GTTCAAGAACAGGCCGGGCACGG + Intronic
1150673518 17:67223458-67223480 TATCCAAACTTGGCCGGGCGTGG + Intronic
1150895899 17:69210477-69210499 TAACCACTAAAGGCCGGGCGCGG - Intronic
1150932696 17:69602424-69602446 TACCCAAATCTGGCCGGGCGCGG - Intergenic
1151286036 17:73111915-73111937 CTTCAAGGACAGGCCGGGCGCGG + Intergenic
1151392389 17:73796271-73796293 TATAAAGAACAGGCCAGGCATGG + Intergenic
1151718146 17:75842035-75842057 AATACAAAAAAGGCCGGGCGTGG - Intronic
1151739096 17:75967178-75967200 AAAACAGAAGAGGCCGGGCGTGG + Intronic
1151742701 17:75994764-75994786 TAATCAAGACAGGCCGGGCGCGG - Intronic
1151797453 17:76355791-76355813 TAGCCAGATGTGGCCGGGCGCGG + Intronic
1151814287 17:76463596-76463618 CTTCCAGAAAAGGCCGGGCACGG - Intronic
1152018241 17:77766071-77766093 GATTTAGAGCAGGCCGGGCGCGG + Intergenic
1152024417 17:77799392-77799414 TACCCCGCAAAGGCCGGGCGCGG + Intergenic
1152052487 17:77992207-77992229 TAAGCAAAACCGGCCGGGCGCGG + Intergenic
1152097825 17:78282162-78282184 TATCGAGATCAGGCCGGGCACGG + Intergenic
1152340023 17:79719184-79719206 AACACAGGACAGGCCGGGCGTGG + Intergenic
1152652752 17:81503273-81503295 TATTGAAAACAGGCTGGGCGCGG + Intergenic
1152763925 17:82125245-82125267 TATACAAAAAAGGCCGGGCATGG + Intronic
1153048561 18:879536-879558 TATCCATCATAGGCCGGGCGCGG - Intergenic
1153150315 18:2085077-2085099 AATCCTAATCAGGCCGGGCGCGG - Intergenic
1153427182 18:4978122-4978144 TCTGCAGAAGCGGCCGGGCGTGG + Intergenic
1153489892 18:5635998-5636020 AGTCCAGACAAGGCCGGGCGCGG - Intergenic
1153579734 18:6560799-6560821 TATCTAAAGCAGGCTGGGCGTGG - Intronic
1153639728 18:7146497-7146519 TATCTAGAAGAGGCCAGGTGCGG + Intergenic
1153806215 18:8710128-8710150 AATACAGGCCAGGCCGGGCGCGG - Intronic
1153841537 18:9012273-9012295 AAACCAGAACAGGCCAGGTGCGG - Intergenic
1154154672 18:11934668-11934690 TAGACAGAAGGGGCCGGGCGCGG + Intergenic
1154364786 18:13698060-13698082 AATTAAGAACTGGCCGGGCGTGG + Intronic
1155194707 18:23462429-23462451 AAACAAGAACAGGCCAGGCGCGG - Intronic
1155235425 18:23813830-23813852 TGTTCAGAATAGGCCGGGTGTGG - Intronic
1155833138 18:30543223-30543245 TTCCCTGAACAGGCTGGGCGCGG - Intergenic
1155939277 18:31787306-31787328 TGTCCAGGACGGGCCGGGCGCGG - Intergenic
1155950056 18:31902022-31902044 TATGCTGAACTGGCCGGGTGTGG + Intronic
1156172346 18:34500752-34500774 AATATAGAACTGGCCGGGCGTGG - Intronic
1156267095 18:35498681-35498703 GATTAAGAACCGGCCGGGCGTGG - Intergenic
1156320471 18:36016511-36016533 TTAACAAAACAGGCCGGGCGCGG - Intronic
1157221825 18:45833601-45833623 AATGCACAAGAGGCCGGGCGTGG - Intronic
1157667679 18:49501336-49501358 TATGCAGAATAAGCCAGGCGTGG - Intergenic
1158301523 18:56058052-56058074 TCCCCAGAGGAGGCCGGGCGCGG - Intergenic
1158612773 18:58957771-58957793 GATTCAGAACTGGCCGGGCATGG + Intronic
1158970895 18:62665449-62665471 TATGCAGAGTTGGCCGGGCGTGG + Intergenic
1158981844 18:62770398-62770420 TAACCAGAGTAGGCCGGGCACGG - Intronic
1159239196 18:65719392-65719414 AATGCACAATAGGCCGGGCGCGG + Intergenic
1159456584 18:68667426-68667448 TATATAGAACCGGCCTGGCGTGG + Intergenic
1159658088 18:71057126-71057148 TAGCCTGATGAGGCCGGGCGCGG + Intergenic
1159781149 18:72662128-72662150 TATACAAAATAGGCCGGGCGCGG + Intergenic
1159833789 18:73311617-73311639 TGTCAAGAATAGGCCGGGCGCGG + Intergenic
1160114847 18:76068214-76068236 TACACAGATCAGGCTGGGCGCGG - Intergenic
1160242835 18:77135424-77135446 TATTCAGTCCTGGCCGGGCGTGG - Intergenic
1160350365 18:78173355-78173377 CTTTAAGAACAGGCCGGGCGCGG - Intergenic
1160713239 19:563111-563133 GAATCTGAACAGGCCGGGCGTGG - Intergenic
1160794411 19:938132-938154 AGTCGACAACAGGCCGGGCGCGG - Intronic
1160861938 19:1240980-1241002 TAAGCAGGTCAGGCCGGGCGCGG - Intergenic
1161132334 19:2598365-2598387 AATACAGAATTGGCCGGGCGTGG + Intronic
1161161941 19:2766724-2766746 AAGCAAGAAGAGGCCGGGCGCGG - Intronic
1161182452 19:2893430-2893452 AATACAGAATTGGCCGGGCGTGG + Intergenic
1161212336 19:3073934-3073956 AAACCACAACAGGCCAGGCGTGG - Intergenic
1161218543 19:3106944-3106966 AACGCAAAACAGGCCGGGCGCGG + Intronic
1161546807 19:4885972-4885994 TTTAAAAAACAGGCCGGGCGTGG + Intergenic
1161679861 19:5674503-5674525 TAATAAGAAGAGGCCGGGCGCGG - Intergenic
1161754842 19:6124834-6124856 AAGCCAGAAAAGGCCAGGCGCGG - Intronic
1161795807 19:6386093-6386115 AAACTAAAACAGGCCGGGCGTGG + Intronic
1161797543 19:6395915-6395937 TACCCCTAAGAGGCCGGGCGCGG + Intergenic
1162083763 19:8235903-8235925 AAAACAAAACAGGCCGGGCGCGG + Intronic
1162129144 19:8514717-8514739 AATAAAGAACTGGCCGGGCGCGG - Intergenic
1162324359 19:9990101-9990123 TAACTAAAAGAGGCCGGGCGTGG + Intronic
1162355162 19:10178834-10178856 ATTCCAGAAGAGGCTGGGCGCGG + Intronic
1162408204 19:10488640-10488662 AAAACAAAACAGGCCGGGCGCGG + Intronic
1162427787 19:10607201-10607223 TAGCCCCAAGAGGCCGGGCGAGG - Intronic
1162589237 19:11579632-11579654 AAACAAAAACAGGCCGGGCGCGG - Intronic
1162661186 19:12170216-12170238 AAACCACAAAAGGCCGGGCGCGG - Intronic
1162731718 19:12722304-12722326 CAGCTAGAACGGGCCGGGCGGGG - Intronic
1162799756 19:13103904-13103926 TATGCAGTAAAGGCCGGGCTTGG + Intergenic
1163116169 19:15189807-15189829 TAAAAACAACAGGCCGGGCGCGG - Intronic
1163319054 19:16561700-16561722 TCTCCAGAACAGGCGGGAAGAGG - Intronic
1163341724 19:16712304-16712326 TATCAGGTACAGGCCGGGTGTGG - Intergenic
1163401611 19:17096978-17097000 CAGCAACAACAGGCCGGGCGTGG - Intronic
1163575215 19:18107104-18107126 TAGCCAGAGTAGGCCGGGTGCGG - Intronic
1163600692 19:18247584-18247606 TACCCAGAGCTGGCCAGGCGCGG - Intronic
1163662515 19:18587292-18587314 TAACCACTCCAGGCCGGGCGCGG + Intronic
1163763915 19:19151830-19151852 AATCCAGATCAGGCCGGTCACGG + Intronic
1164000874 19:21097154-21097176 TATCCTGAACAGGCCGGGCGTGG - Intronic
1164216387 19:23154217-23154239 AATCTAGAATGGGCCGGGCGTGG - Intergenic
1164537357 19:29095856-29095878 TACCCAGAAATGGCCGGGCACGG - Intergenic
1164968492 19:32509342-32509364 TATGAACAACAGGCCGGGTGCGG - Intergenic
1165044736 19:33095690-33095712 AACCCCGACCAGGCCGGGCGCGG - Intronic
1165128680 19:33618967-33618989 GAACCAGAACAGGCTGGGCATGG - Intergenic
1165296921 19:34934937-34934959 TTTAAAAAACAGGCCGGGCGCGG + Intronic
1165378427 19:35460393-35460415 GAAGCACAACAGGCCGGGCGCGG + Intergenic
1165548786 19:36565410-36565432 AATGAAGAACAGGCCGGGCGCGG + Intronic
1165559640 19:36667936-36667958 TCTCAAAAAGAGGCCGGGCGCGG - Intergenic
1165692508 19:37874529-37874551 CAACAACAACAGGCCGGGCGTGG + Intergenic
1165911061 19:39227966-39227988 TAAAAAGAATAGGCCGGGCGTGG + Intergenic
1166144116 19:40822529-40822551 TAGCTAGAGCTGGCCGGGCGCGG + Intronic
1166183496 19:41124551-41124573 TAGCTAGAGCTGGCCGGGCGCGG - Intronic
1166194481 19:41196904-41196926 TTTACAGAACAGGCCAGGTGCGG + Intronic
1166396121 19:42442522-42442544 TATCTGCAACTGGCCGGGCGCGG - Intronic
1166664236 19:44669108-44669130 TATACTGAATAGGCCAGGCGTGG - Intronic
1166834961 19:45661731-45661753 TAACCAGAAAAGGCCTGGTGCGG - Intergenic
1166924135 19:46254355-46254377 AATAAAGAACAGGCCAGGCGCGG + Intergenic
1166924805 19:46260243-46260265 TAGACAAAAAAGGCCGGGCGCGG - Intergenic
1167115319 19:47486063-47486085 AAACCAAAACAGGCCGGGCCTGG + Intergenic
1167187930 19:47960655-47960677 TAGCCAAAACAGGCTGGGCATGG + Intergenic
1167303603 19:48694544-48694566 TATGCAAAACAGGCCAGGTGTGG - Intergenic
1167368728 19:49068188-49068210 AAGGCAGAAAAGGCCGGGCGCGG - Exonic
1167378191 19:49123317-49123339 CAACGATAACAGGCCGGGCGTGG - Intronic
1167396231 19:49231235-49231257 AAACTAAAACAGGCCGGGCGTGG - Intergenic
1167697000 19:51020657-51020679 GATCCTGAGCTGGCCGGGCGCGG + Intergenic
1167868798 19:52350385-52350407 TATACAGCATTGGCCGGGCGTGG + Intronic
1167998457 19:53425807-53425829 AATGCAGCACAGGCCGGGCGTGG + Intronic
1168007850 19:53505694-53505716 AATGCAGCAGAGGCCGGGCGTGG + Intergenic
1168052600 19:53840665-53840687 AGTCCAGAACAGGCCGGGAGCGG + Intergenic
1168217076 19:54934229-54934251 TACCAAAAACAGGCCGGGTGCGG - Intronic
1168362335 19:55752529-55752551 TAACTAAAAGAGGCCGGGCGCGG - Intergenic
1168514180 19:56996984-56997006 TATTCAGTACAGGCCGGGTGCGG + Intergenic
1168608874 19:57782967-57782989 TAAGCAGAACAGGCCGGGCACGG - Intronic
1168621515 19:57883066-57883088 TAAACAGAACTGGCCGGGTGTGG + Intronic
1168653244 19:58107263-58107285 TATTCAGCACAGGCCGGGCATGG + Intronic
1168656706 19:58134643-58134665 AACACAGAGCAGGCCGGGCGCGG + Intronic
925236852 2:2286270-2286292 AATGAAGAACAGGCCGGGTGTGG - Intronic
926035948 2:9635796-9635818 TATCCATATCTGGCCAGGCGTGG - Intergenic
926058096 2:9788155-9788177 CATCCAGATCAGGCCGAGCACGG - Intergenic
926183152 2:10664138-10664160 AAAACAGAACAGGCCGGGCATGG + Intronic
926194562 2:10754865-10754887 TAATCATAATAGGCCGGGCGCGG - Intronic
927189045 2:20503971-20503993 TAACCACAATGGGCCGGGCGTGG - Intergenic
927229520 2:20808369-20808391 TAACAAGACAAGGCCGGGCGCGG + Intronic
927500553 2:23580078-23580100 AATCTAGACCAGGCCGGGCGCGG + Intronic
927612239 2:24552653-24552675 TATAAAGCACAGGCCGGGAGCGG - Intronic
927682409 2:25148630-25148652 ACTTCAGAACTGGCCGGGCGCGG + Intronic
927741325 2:25572175-25572197 TATCTGCACCAGGCCGGGCGCGG + Intronic
927752702 2:25684003-25684025 TACTAAGAACAGGCTGGGCGTGG - Intergenic
927886365 2:26721157-26721179 TGTCCAGCACAGGCCTGGGGTGG - Intronic
928666712 2:33557417-33557439 AATCCAGACAAGGCCGGGCACGG + Intronic
928987779 2:37197579-37197601 TAACCCCAAGAGGCCGGGCGTGG + Intronic
929205753 2:39290778-39290800 TAACAATAACGGGCCGGGCGTGG + Intronic
929222312 2:39477239-39477261 TATCTATAACAGGCTGGGCATGG - Intergenic
929506862 2:42535094-42535116 GACCCAGTACAGGCTGGGCGCGG + Intronic
930160595 2:48152550-48152572 CATCTAGAATAGGCCGGGCATGG + Intergenic
930163043 2:48177542-48177564 TTTCCACCAGAGGCCGGGCGTGG + Intergenic
930352992 2:50281012-50281034 AATCCATAATAGGCCGGGCGCGG + Intronic
930406990 2:50971292-50971314 AAACAATAACAGGCCGGGCGTGG + Intronic
930624085 2:53677057-53677079 AATACAGTATAGGCCGGGCGCGG - Intronic
930785437 2:55267447-55267469 TATTCAGTATAGGCCAGGCGCGG - Intronic
930808447 2:55516636-55516658 TATGTATAACAGGCCGGGTGCGG - Intergenic
930814296 2:55576450-55576472 AAACAAAAACAGGCCGGGCGCGG + Intronic
931317431 2:61145711-61145733 AATACAAAACAGGCCGGGCGCGG - Intronic
931378783 2:61732641-61732663 TATCTAGAACAGGCCGGGCGCGG - Intergenic
932122014 2:69110566-69110588 GTTACAAAACAGGCCGGGCGCGG + Intronic
932242698 2:70170047-70170069 AATAAAAAACAGGCCGGGCGCGG - Intronic
932721705 2:74143447-74143469 AAAACAGAACAGGCCAGGCGCGG - Intronic
932856288 2:75237084-75237106 AATCAAGAAGAGGCCGGGCGCGG - Intergenic
933936726 2:87210699-87210721 AAACCAAAACAGGCCGGGCAAGG - Intergenic
934554372 2:95279583-95279605 TATGCAGAAGCGGCCGGGCGCGG - Intronic
935016492 2:99187533-99187555 TATCCACACCCGGCTGGGCGCGG + Intronic
935232447 2:101110684-101110706 GAACCAGAACAGGCCAGGCGCGG + Intronic
936134557 2:109878483-109878505 AAACAAAAACAGGCCGGGCGCGG - Intergenic
936210140 2:110493002-110493024 AAACAAAAACAGGCCGGGCGCGG + Intergenic
936356419 2:111755126-111755148 AAACCAAAACAGGCCGGGCAAGG + Intergenic
936552295 2:113456006-113456028 TAACAAGTTCAGGCCGGGCGTGG - Intronic
936704230 2:115052659-115052681 AATGGAAAACAGGCCGGGCGTGG + Intronic
936760333 2:115771362-115771384 AATACAGTACAGGCCGGGCGTGG - Intronic
936864179 2:117058086-117058108 AAACCATAACAGGCCAGGCGCGG - Intergenic
937127400 2:119483208-119483230 CATCCAGCACAGGCCTGGCATGG - Intronic
937493771 2:122396867-122396889 TATCAAAAACTGGCCGGGCTCGG - Intergenic
937945664 2:127333806-127333828 AATACAGATCAGGCCAGGCGCGG + Intronic
937970383 2:127544868-127544890 TAGCCAGACGTGGCCGGGCGCGG - Intronic
938020298 2:127900933-127900955 TCCCCTGGACAGGCCGGGCGCGG - Intergenic
938086964 2:128408055-128408077 AAAGCAAAACAGGCCGGGCGCGG - Intergenic
939252182 2:139696238-139696260 AGTACACAACAGGCCGGGCGCGG - Intergenic
940370287 2:152893678-152893700 AATCCAGTAGAGGCCAGGCGCGG - Intergenic
940563511 2:155331904-155331926 TCTCTACAATAGGCCGGGCGCGG - Intergenic
940649377 2:156426211-156426233 TACCCAGACTTGGCCGGGCGTGG - Intergenic
940918100 2:159280399-159280421 TACCCAGAAGTGGCCGGGCGCGG + Intronic
941645730 2:168039300-168039322 AAAGCAGATCAGGCCGGGCGCGG + Intronic
941817631 2:169813562-169813584 TACCTAAAACTGGCCGGGCGCGG + Intronic
941821738 2:169850467-169850489 GATCCAGAGCAGGCCGGGTGCGG - Intronic
941834072 2:169996987-169997009 AATCCAAAGCAGGCCGGGCATGG - Intronic
942181555 2:173385434-173385456 AATGAAAAACAGGCCGGGCGTGG + Intergenic
942341751 2:174956478-174956500 AATGAATAACAGGCCGGGCGTGG + Intronic
943438902 2:187901758-187901780 TAGCCAGGGCAGGCCGGGCGCGG + Intergenic
943966298 2:194338171-194338193 AATCCAGCTGAGGCCGGGCGCGG + Intergenic
944103156 2:196051482-196051504 TATGCAAAACCGGCCAGGCGCGG + Intronic
944367182 2:198935501-198935523 AATACAAAACAAGCCGGGCGTGG - Intergenic
944714090 2:202361742-202361764 AATCTATAAAAGGCCGGGCGCGG - Intergenic
944778219 2:202991111-202991133 GATAAAGAACTGGCCGGGCGCGG + Intronic
945081238 2:206088036-206088058 AATCCAGAATAGGCCGGGCGCGG - Intergenic
945151540 2:206796906-206796928 AATGCAGAATAGGCCGGGCACGG + Intergenic
945181407 2:207095336-207095358 GAACAAAAACAGGCCGGGCGTGG - Intronic
945448301 2:209964496-209964518 TAACAAGATAAGGCCGGGCGCGG + Intronic
946262527 2:218506573-218506595 AAGCCAGAAAGGGCCGGGCGTGG - Intronic
946390271 2:219411050-219411072 TTTCCAGATTAAGCCGGGCGTGG - Intergenic
946739310 2:222786174-222786196 AATCTGGAACAGGCCGGGTGCGG - Intergenic
946830362 2:223722365-223722387 TAGCGTGAACAGGCCGGGCGTGG - Intergenic
947417863 2:229917088-229917110 TACCAAGCACTGGCCGGGCGCGG + Intronic
947457448 2:230268231-230268253 TAGACAGAAGAGGCCGGGTGTGG + Intronic
948255752 2:236567287-236567309 AATGCAGACCCGGCCGGGCGCGG - Intergenic
948297080 2:236868664-236868686 AATTAAGACCAGGCCGGGCGCGG - Intergenic
948960036 2:241327758-241327780 TAGCCAGATCAGGCCTGGTGTGG + Intronic
1169126501 20:3131716-3131738 TATACAACACAGGCTGGGCGTGG + Intronic
1169147125 20:3260047-3260069 TTTTAAGTACAGGCCGGGCGCGG + Intronic
1169202801 20:3721652-3721674 ACTCCAGAAAAGGCTGGGCGCGG + Intergenic
1169261939 20:4145642-4145664 CACCCAAAACAGGCCGGGCGCGG + Intronic
1169561496 20:6805627-6805649 TATACAAAATAGGCCGGGCGTGG + Intergenic
1169978817 20:11360619-11360641 AAACCAGTACAGGCTGGGCGTGG - Intergenic
1170110474 20:12799192-12799214 AATCAAAGACAGGCCGGGCGCGG + Intergenic
1170141952 20:13133441-13133463 TCTCCATAACAGGTCGGGCATGG + Intronic
1170640330 20:18146367-18146389 TATAAAAAACAGGCCAGGCGCGG + Intronic
1170683995 20:18552521-18552543 TATACAGCACAGGCCGGGTGTGG + Intronic
1170826195 20:19798139-19798161 TAAGTAGAATAGGCCGGGCGTGG - Intergenic
1170978484 20:21188996-21189018 AATACAAAACAGGCTGGGCGGGG - Intronic
1170995970 20:21359239-21359261 TTTATAAAACAGGCCGGGCGCGG + Intronic
1171908068 20:30916969-30916991 TATCAAGAAAAGGCCAGGCACGG - Intergenic
1172283861 20:33727352-33727374 AAACTAAAACAGGCCGGGCGTGG + Intergenic
1172389156 20:34554660-34554682 AAACAAAAACAGGCCGGGCGCGG - Intronic
1172406354 20:34692667-34692689 CAACAACAACAGGCCGGGCGCGG - Intergenic
1172421565 20:34823225-34823247 AACCCAGAATAGGCTGGGCGCGG + Intronic
1172636507 20:36413707-36413729 TGTCCAGAATAGGCCGGGCGCGG - Intronic
1172739455 20:37154287-37154309 AATCCAGAAGAGGACGGGCGTGG + Intronic
1172987510 20:39004353-39004375 TCTTCACAACAGGCCGGGCACGG - Intronic
1173471785 20:43329655-43329677 TGCCAAGAAAAGGCCGGGCGCGG + Intergenic
1173587330 20:44192749-44192771 ATTCCAGAACAGGCTGGGCACGG + Intergenic
1173928954 20:46802449-46802471 TATCCAGAAGAGGAATGGCGGGG + Intergenic
1174021914 20:47537097-47537119 AAAACAAAACAGGCCGGGCGCGG - Intronic
1174156667 20:48520082-48520104 TTTACTGATCAGGCCGGGCGTGG + Intergenic
1174195956 20:48772974-48772996 TGTCCATAACTGGCCAGGCGCGG + Intronic
1174312345 20:49667541-49667563 AAACAACAACAGGCCGGGCGCGG - Intronic
1174318641 20:49722706-49722728 TATCAAGTACTGGCCGGGCATGG + Intergenic
1174608268 20:51777381-51777403 TACCCACAACAGGCCGGGCGCGG + Intergenic
1174770061 20:53291179-53291201 TATCAAGAGCAGGCTGGGAGCGG + Intronic
1174805740 20:53603137-53603159 TATAGACAACAGGCCGGGCGCGG + Intronic
1175637938 20:60601161-60601183 AATCGAGACCAGGCCGGGTGTGG - Intergenic
1176213480 20:63937359-63937381 AAACAAAAACAGGCCGGGCGCGG - Intergenic
1176341808 21:5705982-5706004 TTTATAGAACAGGCCGGGGGCGG + Intergenic
1176474062 21:7138134-7138156 TTTATAGAACAGGCCGGGGGCGG + Intergenic
1176503019 21:7618474-7618496 TTTATAGAACAGGCCGGGGGCGG - Intergenic
1176536129 21:8104051-8104073 TTTATAGAACAGGCCGGGGGCGG + Intergenic
1177034394 21:16024005-16024027 AAGCAAGAACAGGCCAGGCGTGG + Intergenic
1177152049 21:17464986-17465008 CATCAGCAACAGGCCGGGCGTGG + Intergenic
1177171708 21:17662501-17662523 TATCAGGAAAGGGCCGGGCGCGG + Intergenic
1177229074 21:18295860-18295882 GAATCAGAATAGGCCGGGCGCGG + Intronic
1177625390 21:23653324-23653346 TATTATGTACAGGCCGGGCGAGG + Intergenic
1177679511 21:24347556-24347578 TATTGAGAAGAGGCTGGGCGTGG - Intergenic
1177830459 21:26133493-26133515 CAACTAGAATAGGCCGGGCGCGG + Intronic
1178310024 21:31522159-31522181 TATTAAGAGCCGGCCGGGCGTGG - Intronic
1178325768 21:31644312-31644334 TATCCAGTTTAGGCCGGGCGTGG + Intergenic
1178662544 21:34519685-34519707 TCCCAAGCACAGGCCGGGCGCGG - Intronic
1178987340 21:37318125-37318147 AATCCAAAACTGGCCGGGCGCGG + Intergenic
1180637745 22:17274420-17274442 TAACTAAAATAGGCCGGGCGCGG - Intergenic
1180655991 22:17421323-17421345 TAGCCAGGCAAGGCCGGGCGCGG + Intronic
1180754520 22:18151764-18151786 AATGCAAAATAGGCCGGGCGCGG + Intronic
1181005388 22:20011018-20011040 TCTCCAGTACAGGGAGGGCGGGG + Intronic
1181143823 22:20828841-20828863 AATCCTCAACAGGCCAGGCGTGG - Intronic
1181227418 22:21400738-21400760 AATTTAAAACAGGCCGGGCGCGG + Intergenic
1181789422 22:25252734-25252756 AATCAAGATCAGGCCGAGCGCGG + Intergenic
1181828244 22:25537474-25537496 TACCCAAAGGAGGCCGGGCGCGG + Intergenic
1181845148 22:25700872-25700894 TACCCAAAAGAGGCCGGGCGCGG - Intronic
1182295955 22:29311390-29311412 CATGCAGAACAGGCAGGGAGAGG - Intronic
1182361023 22:29746574-29746596 AATCCAGAGCAGGCAGGGCATGG - Intronic
1182417358 22:30229768-30229790 TTTGTGGAACAGGCCGGGCGTGG + Intergenic
1182660378 22:31920761-31920783 AATACAGAACAGGCCGGGTGTGG + Intergenic
1182694119 22:32185187-32185209 TCTCCAGAAGGGGCAGGGCGCGG - Intergenic
1182902888 22:33913120-33913142 TATCAAAATCAGGCCGGGCTTGG - Intronic
1182906056 22:33937317-33937339 AACACAAAACAGGCCGGGCGCGG - Intergenic
1183151496 22:36041407-36041429 GAACAAGAACAGGCCAGGCGCGG + Intergenic
1183217581 22:36490864-36490886 TATGAAGAAACGGCCGGGCGTGG + Intronic
1183435935 22:37795190-37795212 TATACAAAATAGGCCGGGCGCGG - Intergenic
1183863625 22:40686902-40686924 TTGCCAGATCAGGCCGGGCACGG + Intergenic
1183865005 22:40697332-40697354 TGTCCAGAATAGGCTGGGCATGG + Intergenic
1183913715 22:41099321-41099343 AAACAAAAACAGGCCGGGCGCGG - Intronic
1184000122 22:41667174-41667196 AAACCAGAAGAGGCCGGGCGCGG + Intergenic
1184126498 22:42491118-42491140 TAGCAATAACAGGCTGGGCGTGG + Intergenic
1184364906 22:44044478-44044500 AATACAAAACAGGCCGGGCGTGG - Intronic
1184464359 22:44660163-44660185 ACCCCAGATCAGGCCGGGCGCGG - Intergenic
1184614240 22:45627127-45627149 TTTAAAAAACAGGCCGGGCGCGG - Intergenic
1184731600 22:46373776-46373798 TGTCCAGAGCAGGCCGGTTGGGG - Intronic
1184742302 22:46435987-46436009 TGTTCATAACAGGCCGGGCGTGG - Intronic
1184827232 22:46960649-46960671 TACCCAGTCCAGGCCAGGCGCGG + Intronic
1185287263 22:50007946-50007968 TGTCTAGAACAGGCCAGGCATGG + Intronic
1185290663 22:50025374-50025396 TACACAGAAGAGGCCGGGCGCGG + Intronic
1185319046 22:50192051-50192073 TATCCCAAACAGGCCAGGCGCGG - Intronic
1185322459 22:50208139-50208161 CAGCCACAACAGGCCAGGCGCGG + Intronic
1185334400 22:50265184-50265206 TGTCCAGCACAGGCTGGGAGCGG - Intronic
1185384382 22:50525177-50525199 AACCCAGAACCGCCCGGGCGGGG - Intronic
1185405505 22:50646292-50646314 AATTCAGAACAGGCTGGGCACGG + Intergenic
1203241076 22_KI270733v1_random:20462-20484 TTTATAGAACAGGCCGGGGGCGG + Intergenic
949548662 3:5094582-5094604 TATCCACCACAGGCCGGGAGCGG + Intergenic
950398502 3:12752506-12752528 TGCCCAGGACCGGCCGGGCGCGG + Intronic
951173299 3:19568503-19568525 TCTCCAGTACTAGCCGGGCGTGG + Intergenic
951810439 3:26693038-26693060 GATCAAGAGCAGGCCGGGCGCGG + Intronic
951971812 3:28454132-28454154 TATACACAATTGGCCGGGCGCGG - Intronic
952468506 3:33618236-33618258 TATCCTCACCAGGCCGGGCGCGG - Intronic
952498273 3:33935184-33935206 TGTCCAGAATAGGCCGGGCGCGG - Intergenic
952938214 3:38417899-38417921 TATATATATCAGGCCGGGCGTGG + Intronic
953164019 3:40448129-40448151 TACCTAAAAGAGGCCGGGCGCGG + Intergenic
953269861 3:41431057-41431079 TAAAGACAACAGGCCGGGCGCGG + Intronic
953349072 3:42201166-42201188 AATACAGACCTGGCCGGGCGTGG + Intronic
953377073 3:42437658-42437680 TGTCCAGAATAGGCCAGGAGAGG + Intergenic
953495410 3:43382227-43382249 AACCAAGATCAGGCCGGGCGCGG + Intronic
953795119 3:45979148-45979170 ACTCCAGAACAGGCCGGGCGCGG - Intronic
953992101 3:47491939-47491961 AACCCAAAACCGGCCGGGCGTGG - Intergenic
954250480 3:49363442-49363464 TAACCAAAAGAGGCTGGGCGTGG + Intronic
954252128 3:49376129-49376151 TAGCAAGAACAGGCCAGGCGTGG - Intronic
954300161 3:49696934-49696956 TAACCAGTCCAGGCCGGGTGTGG - Intronic
954343498 3:49974975-49974997 TAGCCAGGAGAGACCGGGCGTGG - Intronic
954542748 3:51406051-51406073 AAACAAAAACAGGCCGGGCGTGG + Intronic
954606984 3:51919696-51919718 TATACAGATGAGGCCGGGTGCGG + Intergenic
955142278 3:56281145-56281167 TATAGAGGACAGGCCGGGCACGG + Intronic
955357211 3:58241018-58241040 TATCCAGGTTTGGCCGGGCGCGG - Intronic
956606502 3:71078120-71078142 TATACAGAGGAGGCCGGGCGGGG - Intronic
956840589 3:73136177-73136199 TATACAGAATAGGCCAGGTGCGG - Intergenic
957892733 3:86380691-86380713 TATACACATCAGGCCGGGCATGG - Intergenic
957899733 3:86473839-86473861 TAACTAGAATAGGCCGGGTGCGG - Intergenic
959087958 3:101871059-101871081 TATCATGCAGAGGCCGGGCGCGG - Intergenic
959784998 3:110285332-110285354 AACCCAGAATAGGCCTGGCGCGG - Intergenic
960076478 3:113491328-113491350 TATCTATAGCAGGCCGGGCGTGG + Intronic
960076700 3:113494355-113494377 TATTCACAATTGGCCGGGCGCGG + Intronic
960116125 3:113894567-113894589 AAAACAGTACAGGCCGGGCGTGG - Intronic
960139383 3:114137699-114137721 TAGCCAGATGTGGCCGGGCGCGG + Intronic
961693647 3:128688767-128688789 AATCCAAGATAGGCCGGGCGCGG + Intergenic
961756730 3:129132117-129132139 GATACAGAACTGGCCGGGGGTGG - Intronic
961835371 3:129653735-129653757 TAGCAAGAACAGGCCGGGCATGG - Intronic
962396791 3:135022258-135022280 CAAACACAACAGGCCGGGCGCGG - Intronic
962771277 3:138612389-138612411 TAGCCAGACAAGGCCGGGCGCGG - Intronic
963180166 3:142346769-142346791 TATTCAGAAAAGGCAGGGCACGG - Intronic
963229557 3:142895507-142895529 TACTAACAACAGGCCGGGCGCGG + Intergenic
963739049 3:149056817-149056839 AATACAGAATGGGCCGGGCGCGG + Intronic
964038151 3:152223559-152223581 AATGCAGTACAGGCCGGGCGCGG - Intergenic
964230516 3:154461574-154461596 TATACAGAATTAGCCGGGCGTGG - Intergenic
964349393 3:155787899-155787921 CAACCAGTATAGGCCGGGCGCGG + Intronic
964428664 3:156580311-156580333 TATCCAGCACAGACCTGGCCTGG + Intergenic
964539592 3:157764841-157764863 TATCCAATACTGGCCAGGCGCGG + Intergenic
964628233 3:158779826-158779848 AATCAAAAAGAGGCCGGGCGTGG - Intronic
964797755 3:160518423-160518445 AACTCAGAATAGGCCGGGCGCGG - Intronic
965966760 3:174501010-174501032 TATCCAATACAGGCCGGGCATGG - Intronic
966100950 3:176268365-176268387 AAAATAGAACAGGCCGGGCGTGG - Intergenic
966379110 3:179325601-179325623 TAAACTGAAAAGGCCGGGCGCGG + Intronic
966693173 3:182762318-182762340 AATCCATCACAGGCCAGGCGCGG + Intergenic
966703506 3:182883663-182883685 AATGCAGACTAGGCCGGGCGCGG + Intronic
966844217 3:184114473-184114495 TATTCAGGGCAGGCCGGGTGCGG + Intergenic
967115160 3:186330824-186330846 AATCCAGACCAGGCTGAGCGGGG - Intronic
967217730 3:187224634-187224656 TACTCAGCACAGGCCGGGCGCGG - Intronic
967284924 3:187859720-187859742 AATCAAGTATAGGCCGGGCGTGG + Intergenic
967347583 3:188475610-188475632 TATGAAAAGCAGGCCGGGCGTGG + Intronic
967634661 3:191787446-191787468 AATGATGAACAGGCCGGGCGCGG + Intergenic
967862216 3:194160698-194160720 TCTCCAGGACAGGCCGGGGATGG - Intergenic
968009077 3:195261140-195261162 AGGCCTGAACAGGCCGGGCGCGG + Intronic
968024139 3:195424587-195424609 TAGTCAAAACTGGCCGGGCGCGG - Intronic
968039402 3:195575914-195575936 TTTCTAGAATAGGCCAGGCGCGG - Intronic
968039988 3:195580693-195580715 TACCCTCAACAGGCCGGGTGCGG - Intronic
968182081 3:196603223-196603245 TATGCAGAAGAGACCAGGCGCGG + Intergenic
968417221 4:450644-450666 TATCCCAAAAAAGCCGGGCGCGG + Intronic
968587045 4:1423813-1423835 TACCTAAAAGAGGCCGGGCGCGG - Intergenic
969013528 4:4087072-4087094 AATACAGAAAAGGCTGGGCGCGG - Intergenic
969185091 4:5468770-5468792 TATCTAGAGGAGGCCGGGCGCGG + Intronic
969580658 4:8062727-8062749 TACTCAGACCAGGCCGGGCGTGG - Intronic
969798831 4:9546753-9546775 AATCCAGAACAAGCTGGGTGGGG - Intergenic
970218600 4:13784723-13784745 TACCAAAAGCAGGCCGGGCGCGG + Intergenic
970322116 4:14885359-14885381 TATGCAGATCAGGCCAGGCATGG + Intergenic
970349880 4:15191806-15191828 TATGCATAGGAGGCCGGGCGCGG + Intergenic
970838316 4:20437620-20437642 AACCCAAAACAGGCCGAGCGTGG + Intronic
971204012 4:24544820-24544842 TATACAGAATAGGCCAGGCATGG + Intronic
971492875 4:27232641-27232663 TATCCAGAATGGGCCGGGCGTGG - Intergenic
971715135 4:30166356-30166378 TACTGAGAGCAGGCCGGGCGTGG + Intergenic
971990859 4:33891590-33891612 TAAACAGAAAAGGCCCGGCGCGG - Intergenic
972096403 4:35352081-35352103 TATCTACAAGAGGCCAGGCGTGG + Intergenic
972770729 4:42194546-42194568 TATCCAGTCTAGGCCGGGCACGG - Intergenic
972968980 4:44548911-44548933 TATTAAAAACAGGCCAGGCGTGG - Intergenic
973330663 4:48907421-48907443 TATAGAAAACAGGCCGGGTGCGG + Intergenic
973674144 4:53247567-53247589 TAACAAGATCAGGCCGGGCGCGG + Intronic
973772169 4:54217176-54217198 TAAGAAGAACGGGCCGGGCGCGG - Intronic
974084308 4:57243023-57243045 AATCTATGACAGGCCGGGCGTGG - Intergenic
974259768 4:59510683-59510705 TATCACTAAGAGGCCGGGCGCGG - Intergenic
975145283 4:70960170-70960192 TAAGCACAACTGGCCGGGCGTGG - Intronic
975156001 4:71073789-71073811 AATCCAGAAAAGGCCGGGTGCGG + Intergenic
975298015 4:72756418-72756440 AACCCAGAAGAGGCCGGGCGTGG + Intergenic
975602043 4:76111696-76111718 TATACAGAATTAGCCGGGCGTGG - Intronic
976814115 4:89127022-89127044 AAACCAAAACAGGCCGGGCATGG + Intergenic
977310124 4:95375785-95375807 TATACAGAATAGGCCGGGCGTGG + Intronic
977576072 4:98675436-98675458 TATCCACAACTGGCTGGGTGTGG + Intergenic
977941857 4:102868356-102868378 AATCCAAAGCTGGCCGGGCGCGG - Intronic
978089912 4:104702663-104702685 TATGAAGCACTGGCCGGGCGCGG - Intergenic
978101635 4:104848550-104848572 TATCAAGGTCAGGCCGGGCGTGG - Intergenic
978174340 4:105710517-105710539 AAACAAAAACAGGCCGGGCGCGG - Intronic
978351387 4:107824473-107824495 TTTCCGAAACAGGCCGGGTGCGG + Intergenic
978677161 4:111332702-111332724 TATACAAAACAGGCCAGGCAAGG + Intergenic
979292228 4:118990898-118990920 TATCCAGCTTAGGCCGGGCATGG - Intronic
979653977 4:123169769-123169791 AATATAGAACAGGCCGGGCGCGG - Intronic
979783910 4:124691200-124691222 AAAGGAGAACAGGCCGGGCGTGG + Intronic
980117795 4:128696367-128696389 AATTTTGAACAGGCCGGGCGTGG + Intergenic
980249235 4:130292661-130292683 ACTCTAGAACCGGCCGGGCGCGG - Intergenic
981314850 4:143332028-143332050 TATCCAAATCAGGCCGGGCGAGG - Intergenic
981370757 4:143956279-143956301 TAGTAAGAACTGGCCGGGCGCGG + Intergenic
982160995 4:152569368-152569390 TATCTGGCCCAGGCCGGGCGCGG + Intergenic
982452778 4:155572602-155572624 GAACCATAACAGGCTGGGCGCGG + Intergenic
982837948 4:160146469-160146491 AATCTAGCAGAGGCCGGGCGGGG + Intergenic
982922075 4:161288374-161288396 AATCAAAAAGAGGCCGGGCGCGG + Intergenic
983335805 4:166390664-166390686 TTTGGAAAACAGGCCGGGCGCGG + Intergenic
983509539 4:168592312-168592334 AATCCATAATAGGCTGGGCGTGG - Intronic
983943548 4:173561959-173561981 AATCCAGATTAGGCCGGGCGTGG + Intergenic
985026801 4:185746606-185746628 TAACCAGATAAGGCCGGGCGCGG - Intronic
985221055 4:187705959-187705981 TATACATAACAGGCCGGGCGCGG + Intergenic
985229257 4:187797544-187797566 AACACAGAACAGGCCGGGCGCGG - Intergenic
985250405 4:188018485-188018507 TATACAGAAGAGGCTGGGCATGG - Intergenic
985300121 4:188479398-188479420 TCCCTAGAAGAGGCCGGGCGCGG - Intergenic
985335764 4:188892015-188892037 TAGCTAGAAGAGGCCGGGCGCGG - Intergenic
985340527 4:188948069-188948091 TTTAAAGGACAGGCCGGGCGCGG - Intergenic
985616923 5:928294-928316 TATCCAGTCTTGGCCGGGCGTGG + Intergenic
986550894 5:8953732-8953754 TATCAAAAGCTGGCCGGGCGTGG - Intergenic
986607860 5:9540297-9540319 TATGGAGAGAAGGCCGGGCGCGG + Intronic
986785807 5:11112850-11112872 TATCATGTACAGGCTGGGCGCGG + Intronic
987432119 5:17847309-17847331 TTCCCAGTAGAGGCCGGGCGTGG - Intergenic
987554902 5:19434078-19434100 AATCCAGCATTGGCCGGGCGCGG - Intergenic
988141605 5:27249826-27249848 AACCAACAACAGGCCGGGCGCGG + Intergenic
988493606 5:31726236-31726258 TACCCAGCATGGGCCGGGCGCGG + Intronic
988524802 5:31977653-31977675 TGTCCAGAATAGGCCTGGTGAGG + Intronic
988983247 5:36592770-36592792 TATCCAGTAGAGGCCGGGCACGG + Intergenic
989052005 5:37330857-37330879 TATCAACAACAGGCCAGGCATGG + Intronic
989611082 5:43292279-43292301 TATACAGTAAAGGCCGGGTGCGG - Intronic
989772773 5:45164518-45164540 TATTCAGCACAGGCTGGGCGCGG + Intergenic
989970525 5:50519328-50519350 TAAGCAGTACAGGCTGGGCGCGG - Intergenic
990486050 5:56260269-56260291 TCTCCAAAAAAGGCAGGGCGCGG - Intergenic
990567138 5:57041267-57041289 TATACTGATGAGGCCGGGCGCGG + Intergenic
990584473 5:57197069-57197091 AATTCAAAACAGGTCGGGCGTGG - Intronic
990700058 5:58465169-58465191 TCTCCAAAATAGGCCGGGCGCGG + Intergenic
990963472 5:61419110-61419132 TATAAAGAGGAGGCCGGGCGTGG - Intronic
991121087 5:63015241-63015263 TATAAATCACAGGCCGGGCGTGG + Intergenic
992422416 5:76619806-76619828 GATCCTTAACTGGCCGGGCGCGG - Intronic
992431078 5:76712448-76712470 TATACTAAAGAGGCCGGGCGCGG + Intergenic
992641651 5:78773171-78773193 AAACGAAAACAGGCCGGGCGTGG + Intergenic
993782238 5:92081507-92081529 TATCAAGTGCAGGCTGGGCGCGG - Intergenic
993925864 5:93865368-93865390 TATCCAGGATCGGCTGGGCGCGG - Intronic
994358375 5:98821696-98821718 AATGCTCAACAGGCCGGGCGCGG + Intergenic
994581546 5:101648823-101648845 TAATAAGAACAGGCCGGGCGCGG + Intergenic
994814532 5:104568513-104568535 AATACAAAACAGACCGGGCGCGG + Intergenic
994858417 5:105155937-105155959 TATGCAGAATAGGCTGGGCATGG - Intergenic
995045791 5:107644989-107645011 AAAACAGAACAGGCCAGGCGTGG - Intronic
995049298 5:107684208-107684230 AGTCCAGAACAGGCCGGGCGTGG + Intergenic
995136913 5:108688987-108689009 AATCAACAAAAGGCCGGGCGCGG + Intergenic
995576890 5:113546028-113546050 AATGGAGATCAGGCCGGGCGCGG - Intronic
995735796 5:115297961-115297983 TTTGCAGAAGAGGCCGGACGTGG + Intergenic
995879290 5:116826084-116826106 GATGCAGATCAGGCCAGGCGCGG + Intergenic
996555737 5:124777339-124777361 TATCTAGAGAAGGCCGGGTGTGG + Intergenic
996799047 5:127381959-127381981 AAACCAGAACAGGCTGGGTGCGG - Intronic
997866026 5:137463657-137463679 TAACTAAAAGAGGCCGGGCGTGG + Intronic
998015660 5:138729982-138730004 AAGACAGAATAGGCCGGGCGCGG - Intronic
998120539 5:139573009-139573031 TATCAAGATGAGGCTGGGCGCGG + Intronic
998272468 5:140719140-140719162 AACCAAAAACAGGCCGGGCGCGG + Intergenic
998371981 5:141667716-141667738 AATACAGTACTGGCCGGGCGTGG - Intronic
999206953 5:149855824-149855846 AAACAAGAACAGGCTGGGCGCGG + Intergenic
999774039 5:154797521-154797543 ATACCAGAACAGGCCGGGCGCGG - Intronic
999790927 5:154938590-154938612 TATGCACAAGAGGCCGGGTGCGG + Intergenic
999979791 5:156946773-156946795 AATTCAGAAGAGGCCAGGCGCGG - Intronic
1000122068 5:158206965-158206987 TACATGGAACAGGCCGGGCGCGG - Intergenic
1000679180 5:164161434-164161456 CACACAGGACAGGCCGGGCGTGG - Intergenic
1000802600 5:165747574-165747596 TAACCTGACCTGGCCGGGCGCGG + Intergenic
1000823165 5:166010507-166010529 GAAACAGCACAGGCCGGGCGCGG + Intergenic
1001341768 5:170853408-170853430 TATACTGAACAGGCTGGGTGTGG + Intergenic
1001388598 5:171360165-171360187 AATGTAGAACAGGCTGGGCGTGG + Intergenic
1001552663 5:172615694-172615716 GATCCAAAAGAGGCCGGGCGTGG + Intergenic
1001644079 5:173267321-173267343 AAATCAGAACAGGCCGGGCATGG - Intergenic
1001779231 5:174353579-174353601 AAACTAGAGCAGGCCGGGCGCGG - Intergenic
1001972895 5:175970887-175970909 CATACATTACAGGCCGGGCGCGG - Intronic
1002138197 5:177121551-177121573 CATACAGAAAAGGCCAGGCGTGG - Intergenic
1002244543 5:177872902-177872924 CATACATTACAGGCCGGGCGCGG + Intergenic
1002256971 5:177965073-177965095 TAAACATGACAGGCCGGGCGTGG + Intergenic
1002275489 5:178101860-178101882 TACAGAGAAAAGGCCGGGCGCGG - Intergenic
1002421414 5:179151185-179151207 TACACAGTTCAGGCCGGGCGCGG - Intronic
1002435578 5:179228938-179228960 TCTCAAGCACAGGCCGGGGGAGG - Intronic
1002486630 5:179542574-179542596 TATCCAGAATGGGCCAGGTGCGG + Intergenic
1002487374 5:179548840-179548862 AAACAAGACCAGGCCGGGCGTGG + Intergenic
1002569606 5:180132678-180132700 AAGCAAGACCAGGCCGGGCGCGG + Intronic
1002611552 5:180422107-180422129 TATCAGAAACAGGCTGGGCGCGG + Intergenic
1002827026 6:783309-783331 GATACCGAACAGCCCGGGCGTGG - Intergenic
1002933587 6:1652080-1652102 TATCCTTAACAGGCCGGGTGTGG + Intronic
1003059318 6:2850389-2850411 TATCATAAACAGGCTGGGCGCGG - Intergenic
1003086913 6:3068032-3068054 TATGCACATCAGGCCGGGCGCGG - Intronic
1003463322 6:6352522-6352544 TAACCTGCAGAGGCCGGGCGCGG + Intergenic
1003488644 6:6601430-6601452 TATACACTAGAGGCCGGGCGCGG + Intronic
1003640422 6:7870917-7870939 GATCCAAGACAGGCCGGGCGCGG - Intronic
1003692481 6:8368126-8368148 AAAACAGAACAGGCTGGGCGCGG + Intergenic
1003848636 6:10199508-10199530 GAAACAGAACTGGCCGGGCGCGG - Intronic
1004105232 6:12661217-12661239 AATGGAGAAGAGGCCGGGCGCGG - Intergenic
1004256098 6:14066018-14066040 AATCCAGACAAGGCCGGGTGCGG + Intergenic
1004371461 6:15056139-15056161 CAGCCTGACCAGGCCGGGCGAGG + Intergenic
1004521432 6:16364591-16364613 TATCTAGAACTGGCTGGGTGCGG - Intronic
1004886143 6:20053361-20053383 TATCCAGTAAGGGCTGGGCGTGG + Intergenic
1004905774 6:20235737-20235759 TAAAAAGAACAGGCCAGGCGTGG + Intergenic
1005298687 6:24450219-24450241 TATCTAAAATAGGCCGGGCACGG + Intronic
1005565243 6:27086106-27086128 AATCAAGAAAAGGTCGGGCGCGG + Intergenic
1005572311 6:27157255-27157277 TAAAGAGAAGAGGCCGGGCGCGG + Intergenic
1005616933 6:27582521-27582543 TATACAGGACAGGCCGGGCGCGG - Intergenic
1005642795 6:27812860-27812882 TATGGACAACAGGCCGGGCGCGG + Intergenic
1005747902 6:28856096-28856118 TATTCAGAACACGCTGGGCGTGG - Intergenic
1005899418 6:30204949-30204971 AAACCAGAAGCGGCCGGGCGCGG + Intronic
1006484460 6:34327240-34327262 GATCAAAGACAGGCCGGGCGCGG + Intronic
1006842639 6:37039654-37039676 GATGCTGAGCAGGCCGGGCGTGG + Intergenic
1007372641 6:41436634-41436656 TTTCAAGCATAGGCCGGGCGCGG - Intergenic
1007486012 6:42181244-42181266 TACCCAACTCAGGCCGGGCGCGG + Intergenic
1007568963 6:42875405-42875427 TACCTATAACTGGCCGGGCGCGG + Intergenic
1007643077 6:43358550-43358572 TAAACAAAACAGGCTGGGCGCGG - Intronic
1008055272 6:46939158-46939180 TAATCAGAAAAGGCTGGGCGTGG - Intronic
1008959067 6:57247144-57247166 AATCAAGTCCAGGCCGGGCGCGG - Intergenic
1009240614 6:61182017-61182039 GATATATAACAGGCCGGGCGCGG + Intergenic
1009401385 6:63260102-63260124 TGCACAGAAGAGGCCGGGCGCGG - Intergenic
1009575694 6:65456160-65456182 TAAAAAGAACAGGCCGGGCGAGG + Intronic
1010431963 6:75788048-75788070 GATACAGAATAGGCCGGGCATGG - Intronic
1010617859 6:78034785-78034807 TATGCTGTACAGGCTGGGCGTGG - Intergenic
1010648115 6:78418202-78418224 GATACAAAGCAGGCCGGGCGTGG - Intergenic
1010651677 6:78462986-78463008 TCTCCAAAGCAGGCTGGGCGTGG + Intergenic
1010925576 6:81742171-81742193 AAGCCTGAATAGGCCGGGCGCGG + Intronic
1011144728 6:84200986-84201008 TATGCAATGCAGGCCGGGCGCGG + Intronic
1011146458 6:84223208-84223230 AAAACAAAACAGGCCGGGCGTGG + Intronic
1011175226 6:84552408-84552430 AAACAAAAACAGGCCGGGCGCGG - Intergenic
1011571706 6:88744548-88744570 TAGTAAGAACAGGCCGGGCACGG - Intronic
1011886215 6:92098591-92098613 TATCCTGGCTAGGCCGGGCGCGG - Intergenic
1012881511 6:104796398-104796420 TAACTAGAATAGGCTGGGCGTGG - Intronic
1013043730 6:106462447-106462469 AACTCAGAAAAGGCCGGGCGCGG - Intergenic
1013388257 6:109654619-109654641 AATATAGAACAGGCAGGGCGCGG - Intronic
1013949700 6:115764843-115764865 TAGGCAAAATAGGCCGGGCGCGG + Intergenic
1014035238 6:116759595-116759617 AATAAAGATCAGGCCGGGCGCGG - Intronic
1014436437 6:121426008-121426030 TAGTGAGAACAGGCCGGGCGCGG + Intergenic
1014742600 6:125163633-125163655 TAAGTACAACAGGCCGGGCGTGG + Intronic
1015000250 6:128205457-128205479 TTTCAAGAAAAGGCCAGGCGTGG + Intronic
1015600213 6:134904174-134904196 TATCTGCACCAGGCCGGGCGCGG - Intergenic
1016082225 6:139870329-139870351 TAGCCAGAGCAGGCCAGGCGCGG + Intergenic
1016183642 6:141176091-141176113 AAGGCAGCACAGGCCGGGCGCGG - Intergenic
1016405526 6:143725488-143725510 AAGACAGCACAGGCCGGGCGCGG - Intronic
1016723450 6:147329915-147329937 AAGCCTGAAGAGGCCGGGCGCGG - Intronic
1016851753 6:148626620-148626642 TCTTCACAGCAGGCCGGGCGCGG + Intergenic
1016969909 6:149751768-149751790 TATCAAGTACCGGCCTGGCGCGG - Intronic
1016974004 6:149789364-149789386 TAATCAGATCAGGCTGGGCGTGG - Intronic
1017015013 6:150092928-150092950 ACTCCAGAATGGGCCGGGCGTGG + Intergenic
1017110504 6:150928143-150928165 TATCCAAAACAGGCCAAGCGCGG + Intronic
1017778475 6:157698052-157698074 TATTCTGAGCCGGCCGGGCGCGG + Intergenic
1017797183 6:157856037-157856059 AATCAATGACAGGCCGGGCGTGG - Intronic
1017893609 6:158659982-158660004 AACCTTGAACAGGCCGGGCGTGG + Intronic
1018539571 6:164863908-164863930 TACCCAAAACAGGCCAAGCGCGG + Intergenic
1018591095 6:165423575-165423597 TACCCAGATTAGGCCGGGCGCGG + Intronic
1018701633 6:166431916-166431938 TAGCCCGAACAGGCCGGGTGCGG - Intronic
1019049429 6:169171706-169171728 ACTCCAGGAGAGGCCGGGCGTGG + Intergenic
1019468419 7:1203527-1203549 TGTGCAGCAGAGGCCGGGCGCGG + Intergenic
1019675474 7:2309439-2309461 TCACCAGAACCAGCCGGGCGCGG + Intronic
1019683103 7:2363969-2363991 TTTGCAGAATAGGCCGGGCGCGG + Intronic
1019801077 7:3088877-3088899 TAACCAAAAGAGGCCGGGCACGG - Intergenic
1020036849 7:4969021-4969043 TAACTAAAAGAGGCCGGGCGTGG - Intergenic
1020075391 7:5254624-5254646 AAACCAAAAGAGGCCGGGCGCGG + Intergenic
1020199734 7:6070205-6070227 TAACCATCACAGGCCGGGTGTGG + Intergenic
1020224370 7:6268458-6268480 TTACAAGAGCAGGCCGGGCGCGG - Intronic
1020365273 7:7373987-7374009 AAACCAGAAGGGGCCGGGCGCGG - Intronic
1020530088 7:9322286-9322308 AAACTAGAACAGGCCGGGCGCGG - Intergenic
1020981290 7:15072415-15072437 TACCCAAAAAGGGCCGGGCGCGG + Intergenic
1021073712 7:16274335-16274357 CAGCCACAACAGGCCGGGTGTGG - Intronic
1021387911 7:20054712-20054734 TCTACAGAACAGGCCGGGCGCGG + Intergenic
1021576975 7:22113831-22113853 TAATAATAACAGGCCGGGCGTGG + Intergenic
1021746684 7:23747656-23747678 TAATCTGAACAGGCCGGGCATGG - Intronic
1021802451 7:24320767-24320789 TGACCAGAAGAGGCTGGGCGTGG - Intergenic
1021946238 7:25730510-25730532 TATTCAGTATAGGCCGGGCGCGG - Intergenic
1022021950 7:26408518-26408540 TATAGAGAAGAGGCCGGGTGCGG + Intergenic
1022168454 7:27797285-27797307 TAATCAAAATAGGCCGGGCGCGG - Intronic
1022337673 7:29437306-29437328 TATCTAAAACCGGCTGGGCGCGG + Intronic
1022665549 7:32406983-32407005 AAACAAAAACAGGCCGGGCGCGG + Intergenic
1022871712 7:34487024-34487046 AATCCAGTTCTGGCCGGGCGCGG + Intergenic
1022905423 7:34850688-34850710 CCTCAAGGACAGGCCGGGCGCGG - Intronic
1023408971 7:39868984-39869006 TATGTAGAATAGGCTGGGCGCGG + Intergenic
1023429946 7:40080276-40080298 TATTAAGAAAAGGCTGGGCGTGG - Intronic
1023952056 7:44854109-44854131 TAGCCAAAAGAGGCCGGGCGCGG - Intergenic
1024327199 7:48118150-48118172 AATAAAGAACAGGCCGGGTGTGG - Intergenic
1024787151 7:52921525-52921547 TATGAAGAACAGGCTGGGAGCGG + Intergenic
1024827016 7:53402045-53402067 TACACAGTACAGGCCGGGTGCGG - Intergenic
1025031612 7:55561418-55561440 TTTACAGACCAGGCCGGGCACGG + Intronic
1025065796 7:55854716-55854738 CCTCCAGTACAGGCCGGGTGTGG - Intronic
1025970795 7:66323241-66323263 TATCCAGACCAGGCTGGTCTCGG + Intronic
1026021147 7:66707073-66707095 TAACCAGTACGGGCCGGGCGCGG - Intronic
1026681904 7:72473244-72473266 TAGCAAGAACAGGCTGGGCCGGG - Intergenic
1027191593 7:75999834-75999856 TATACATAACAGGCCGGGCGCGG - Intronic
1027342366 7:77222900-77222922 TAACCAGAAGAGGCAGGGAGTGG - Intronic
1027537124 7:79417020-79417042 TAGAAAGAACAGGCCGGGCATGG - Intronic
1027877042 7:83784186-83784208 TATCTAATACAGGCCGGGTGCGG + Intergenic
1028559021 7:92153353-92153375 TAAGCATAAGAGGCCGGGCGTGG - Intronic
1029287203 7:99473908-99473930 TAAAAACAACAGGCCGGGCGTGG - Intronic
1029528124 7:101107958-101107980 TCTGCAGAACAGGCACGGCGGGG + Intergenic
1029654416 7:101914787-101914809 AATCATGGACAGGCCGGGCGAGG - Intronic
1030028518 7:105348225-105348247 AATACAGAATTGGCCGGGCGTGG - Intronic
1030234229 7:107241740-107241762 TATGAAGCACAGGCTGGGCGCGG - Intronic
1030250688 7:107440961-107440983 TATCAATCCCAGGCCGGGCGTGG + Intronic
1030396639 7:108994786-108994808 GATCCAGCACAGGCCTGGAGAGG - Intergenic
1031048298 7:116919573-116919595 AATTTAGAACAGGCTGGGCGCGG + Exonic
1031130011 7:117821878-117821900 AATCCTAAACAGGCCAGGCGCGG - Intronic
1032224402 7:130019337-130019359 AAACCAGTGCAGGCCGGGCGTGG - Intronic
1032632806 7:133672099-133672121 TACCTAGTACAGGCCAGGCGTGG + Intronic
1033312031 7:140268442-140268464 TACCCAGTCTAGGCCGGGCGCGG + Intergenic
1033474409 7:141677133-141677155 TGGTCTGAACAGGCCGGGCGTGG + Intronic
1033786702 7:144740428-144740450 TATCCAGTAGAGGCCAGGCATGG + Intronic
1033805010 7:144944007-144944029 GATCAAGAAAAGGCCGGGCACGG - Intergenic
1033809110 7:144990124-144990146 TAAACATAACCGGCCGGGCGCGG + Intergenic
1033834150 7:145288504-145288526 ATCCCAGAACAGGCCGGGCACGG + Intergenic
1034168034 7:149040722-149040744 AATTTAAAACAGGCCGGGCGTGG + Intergenic
1034183394 7:149156014-149156036 TATATAAAACTGGCCGGGCGCGG - Intronic
1034187677 7:149191583-149191605 AATACAGGAGAGGCCGGGCGCGG - Intergenic
1034251517 7:149695230-149695252 AAACAAGAAGAGGCCGGGCGTGG + Intergenic
1034442565 7:151093900-151093922 TATCTGGAACAGGCCAGGCTTGG + Intronic
1034578410 7:152021638-152021660 AATGCAAAACAGGCCAGGCGCGG + Intergenic
1034699683 7:153084974-153084996 GGTACAGAACAGGCCGGGTGCGG - Intergenic
1035190448 7:157163093-157163115 TACCCAGAGATGGCCGGGCGCGG + Intronic
1036061352 8:5324974-5324996 TAGGCAGAGCAGGCCGGGCGCGG + Intergenic
1036255273 8:7201190-7201212 AATACAGAAAAGGCTGGGCGCGG - Intergenic
1036256031 8:7207287-7207309 AATCCAGAACAAGCTGGGTGGGG + Intergenic
1036361455 8:8080212-8080234 AATCCAGAACAAGCTGGGTGGGG - Intergenic
1036439579 8:8768618-8768640 TATCCAGAATAGGCCAGGCATGG - Intergenic
1036813013 8:11880469-11880491 TAAACACAACAGGCCGGGTGTGG + Intergenic
1036832368 8:12031157-12031179 GATACAGCACGGGCCGGGCGCGG + Intergenic
1036889521 8:12586811-12586833 AATCCAGAACAAGCTGGGTGGGG + Intergenic
1036896342 8:12638861-12638883 AATACAGAAAAGGCTGGGCGCGG - Intergenic
1036938070 8:13024331-13024353 TAAAAGGAACAGGCCGGGCGCGG - Exonic
1036954584 8:13173658-13173680 GGAGCAGAACAGGCCGGGCGCGG - Intronic
1037323861 8:17669553-17669575 TGTCCAGTACAGGCCAGGAGTGG + Intronic
1037360495 8:18068833-18068855 TATCCAACCCAGGCCGGGCATGG + Intronic
1037361649 8:18080846-18080868 AAAACAGGACAGGCCGGGCGCGG - Intronic
1037578094 8:20226705-20226727 TATCCAGAACAGGCCGGGCGCGG - Intronic
1037687094 8:21150132-21150154 GAACTGGAACAGGCCGGGCGCGG + Intergenic
1037868447 8:22467715-22467737 CATCTTGAACAGGCCGGGGGCGG - Intronic
1037871261 8:22499147-22499169 AAGTCAAAACAGGCCGGGCGCGG + Intronic
1037955181 8:23050781-23050803 CATCCAGTTAAGGCCGGGCGTGG + Intronic
1038192312 8:25334428-25334450 GATCCAGAATAGGCCAGGCGTGG + Intronic
1038322985 8:26546627-26546649 AATCCTGCAGAGGCCGGGCGTGG + Intronic
1038838729 8:31159006-31159028 AAATGAGAACAGGCCGGGCGTGG + Intronic
1040088112 8:43366354-43366376 TAGCCATTATAGGCCGGGCGCGG + Intergenic
1040468309 8:47715465-47715487 TGTCCAGAATAGGCTGGGGGCGG - Intronic
1040733718 8:50481090-50481112 CATACAGCACAGGCTGGGCGCGG + Intronic
1040808725 8:51425541-51425563 TATTCAGACTAGGCTGGGCGTGG + Intronic
1041045848 8:53885321-53885343 TATACAGCAGAGGCCGGGCGCGG + Intronic
1043043588 8:75293392-75293414 AATACAGAAGTGGCCGGGCGCGG + Intergenic
1043459515 8:80445608-80445630 ACCCCTGAACAGGCCGGGCGCGG + Intergenic
1043464736 8:80493524-80493546 TAACCTGAATAGGCCGGGCGCGG + Intronic
1043609835 8:82048806-82048828 TAAGCAAAAAAGGCCGGGCGCGG - Intergenic
1043668731 8:82853493-82853515 TACACTGAATAGGCCGGGCGCGG + Intergenic
1043884753 8:85586191-85586213 TATCTATAAAAGGCCGGGCGCGG - Intergenic
1044498157 8:92915788-92915810 TGTATAGTACAGGCCGGGCGCGG - Intronic
1044827260 8:96210392-96210414 TTGCCAGATAAGGCCGGGCGCGG + Intergenic
1044866585 8:96576707-96576729 TAAAGAGAATAGGCCGGGCGCGG - Intronic
1044981511 8:97720942-97720964 TATCAAACAGAGGCCGGGCGTGG - Intronic
1045094991 8:98788149-98788171 GATACAGAACTGGCCGGGCATGG + Intronic
1045526410 8:102944363-102944385 AATGGAGAACAGGCCGGGTGTGG + Intronic
1045534366 8:103013226-103013248 ATTCTAGAAGAGGCCGGGCGCGG + Intergenic
1045671972 8:104565567-104565589 TATACAACCCAGGCCGGGCGCGG + Intronic
1045857096 8:106776943-106776965 AATCCACAGCTGGCCGGGCGCGG - Intergenic
1045924262 8:107567808-107567830 TATCCAGAAGAGGCTGGGCATGG + Intergenic
1046748839 8:117905520-117905542 AAACCAAAACAGGCCAGGCGTGG + Intronic
1046927786 8:119811514-119811536 TAACCAAAACAGGCCGGGCACGG + Intronic
1046933364 8:119863303-119863325 TACCCTGTATAGGCCGGGCGCGG + Intergenic
1047949743 8:129922571-129922593 TATCTAATAAAGGCCGGGCGCGG + Intronic
1048552432 8:135446251-135446273 AAGCCAGTAAAGGCCGGGCGTGG + Intergenic
1048859732 8:138715265-138715287 GATTCAGTACAGGCCGGGCATGG + Intronic
1049439144 8:142601302-142601324 TATCAAGGACAGACGGGGCGTGG - Intergenic
1049516643 8:143062375-143062397 AATACACAAGAGGCCGGGCGTGG + Intergenic
1049754044 8:144300499-144300521 AGTACACAACAGGCCGGGCGCGG - Intronic
1049754176 8:144301574-144301596 GCTCCAGAAGAGGCCGGGCGCGG + Intronic
1049900709 9:161176-161198 TAACAAGTTCAGGCCGGGCGTGG + Intronic
1050576303 9:6999374-6999396 TATTAAAAACAGGCCGGGCGCGG + Intronic
1051272867 9:15372143-15372165 GATCCTAAACAGGCCGGGCGTGG - Intergenic
1051277915 9:15414945-15414967 AATCTAGACCAGGCCGGGCGCGG + Intergenic
1051440862 9:17081100-17081122 CATCAAGGTCAGGCCGGGCGTGG - Intergenic
1051594151 9:18807352-18807374 TACATAGTACAGGCCGGGCGCGG + Intronic
1051690434 9:19706666-19706688 AATCAAGACCCGGCCGGGCGCGG - Intronic
1051894512 9:21974180-21974202 TATTCAGAAGCGGCCGGGCGCGG - Intronic
1052288470 9:26815452-26815474 AATGCATATCAGGCCGGGCGCGG + Intergenic
1052839555 9:33280265-33280287 AAACAACAACAGGCCGGGCGCGG - Intronic
1053074112 9:35118236-35118258 AAATCAGAATAGGCCGGGCGCGG - Intergenic
1053091676 9:35283967-35283989 TGAGCAGTACAGGCCGGGCGTGG + Intronic
1053191065 9:36069247-36069269 TATGAAGAGCAGGCCGGGTGCGG + Intronic
1053242082 9:36504294-36504316 TATAAAGAACAGGCTGGGGGCGG + Intergenic
1053403796 9:37852618-37852640 TTTTCAGAACAGGCTGGGCATGG + Intronic
1053450442 9:38189531-38189553 TATCCTGAACAGGGCATGCGAGG + Intergenic
1053743746 9:41171459-41171481 TAACAAGTTCAGGCCGGGCGTGG + Intronic
1054349023 9:64001276-64001298 TAACAAGTTCAGGCCGGGCGTGG + Intergenic
1054483524 9:65693845-65693867 TAACAAGTTCAGGCCGGGCGTGG - Intronic
1055053785 9:72005050-72005072 TATCCAGCACAGGCCGAGCGTGG + Intergenic
1056327506 9:85492165-85492187 AATTGAGAACAGGCCAGGCGTGG + Intergenic
1056353127 9:85771947-85771969 TATCTATATCAGGCTGGGCGCGG - Intergenic
1056528723 9:87468257-87468279 TATTCATAATAGGCCAGGCGCGG + Intergenic
1056984092 9:91345541-91345563 TACCCAGAGAAGGCCAGGCGTGG + Intronic
1057035332 9:91807804-91807826 TTTCCAGAACAGGCCTGTTGGGG + Intronic
1057116295 9:92525598-92525620 AATACAGCACAGGCTGGGCGCGG + Intronic
1057183788 9:93044564-93044586 CATCAAGAACAGGCCAGGTGCGG + Intergenic
1057320637 9:94009583-94009605 TGTTTAGAACAGGCCGGGCGCGG + Intergenic
1057374309 9:94505053-94505075 TAACCAAATTAGGCCGGGCGTGG + Intergenic
1057793360 9:98138756-98138778 AATGCAGAACGGGCTGGGCGCGG + Intronic
1058563185 9:106251132-106251154 AATCCAAGACTGGCCGGGCGCGG - Intergenic
1058909594 9:109508448-109508470 AAAACAGAACAGGCCAGGCGCGG - Intergenic
1059201267 9:112419292-112419314 TGTCAAGGACAGGCCGGGCGTGG - Intronic
1059854951 9:118386002-118386024 GATATATAACAGGCCGGGCGCGG - Intergenic
1060094135 9:120772202-120772224 TATTAAGAATGGGCCGGGCGTGG + Intronic
1060257416 9:122044817-122044839 TATCAAAAACAGGCTGGGCGAGG + Intronic
1060543221 9:124445711-124445733 TATCCAGCACTGGCTGGGTGTGG - Intergenic
1060642178 9:125248332-125248354 TATGAAGAGCTGGCCGGGCGCGG + Intergenic
1060835435 9:126752111-126752133 TACCCAAAACAGGCTGGGCATGG - Intergenic
1060836914 9:126762788-126762810 TGTCCTTTACAGGCCGGGCGTGG - Intergenic
1060918272 9:127403880-127403902 CATCCAGCACAGGCCTGGAGAGG + Intronic
1060953928 9:127624293-127624315 TAACTATAACAGGCCGGGCATGG + Intronic
1060974560 9:127756920-127756942 AAACAAGAACAGGCCAGGCGTGG - Intronic
1061017795 9:127992507-127992529 AAACAACAACAGGCCGGGCGCGG - Intergenic
1061058440 9:128237557-128237579 GAACAAGGACAGGCCGGGCGGGG - Intronic
1061070648 9:128308241-128308263 AAACCAAAACAGGCCGGGTGTGG + Intergenic
1061097775 9:128469702-128469724 TAACAAAAACAGGCCGGGCATGG + Intronic
1061124306 9:128664240-128664262 TATGCTAAACAGGCTGGGCGTGG - Intergenic
1061350592 9:130061651-130061673 TAGCCAGGGCAGGCCGGGCGTGG + Intronic
1061411487 9:130424474-130424496 TATTAAGGACAGGCCGGGCGCGG - Intronic
1061922626 9:133790464-133790486 CAGCAAGAACAGGCTGGGCGCGG - Intronic
1062329630 9:136032604-136032626 TATCCAGAACAGGCCAGGCCTGG + Intronic
1062417785 9:136461814-136461836 CATACTGATCAGGCCGGGCGCGG + Intronic
1203457401 Un_GL000220v1:3533-3555 TTTATAGAACAGGCCGGGGGCGG + Intergenic
1185453263 X:294190-294212 TAGCGGGCACAGGCCGGGCGCGG + Intronic
1185460306 X:330207-330229 TATTAAAAAAAGGCCGGGCGCGG + Intergenic
1185628607 X:1500146-1500168 AAACAACAACAGGCCGGGCGCGG - Intronic
1185729356 X:2448896-2448918 TATCCACACTGGGCCGGGCGCGG + Intronic
1186021080 X:5256321-5256343 TAACCATTACAGGCCGGGTGCGG - Intergenic
1186141521 X:6579370-6579392 TATAAAGTACAGGCCGGGCATGG - Intergenic
1186162175 X:6788997-6789019 TAAACAGAAGAGACCGGGCGCGG + Intergenic
1186737211 X:12478282-12478304 AAACCAGAGTAGGCCGGGCGTGG + Intronic
1186801469 X:13096577-13096599 TATACAGAGGAGGCCGGGCGTGG - Intergenic
1186825433 X:13335059-13335081 TATGAAGATCTGGCCGGGCGTGG - Intergenic
1187027019 X:15446117-15446139 TATCTTGAATAGGCCGGGTGTGG - Intronic
1187137683 X:16563976-16563998 TATGTATAACAGGCCGGGTGTGG - Intergenic
1187266620 X:17739556-17739578 TATCAAGAATTGGCCAGGCGCGG + Intronic
1187321821 X:18246029-18246051 GAGCCAGAACAGGCCAGGCGCGG - Intronic
1187727603 X:22219905-22219927 TAATCAGAATAGGCCAGGCGCGG - Intronic
1187865345 X:23718613-23718635 TAGGCAGAACAGGCCGGGCACGG + Intronic
1187897494 X:23996373-23996395 AAACCATATCAGGCCGGGCGTGG + Intronic
1188020305 X:25149802-25149824 TGCCAAGAACAGGCCGGGCGCGG - Intergenic
1189401216 X:40670469-40670491 TATAAAGGAGAGGCCGGGCGCGG + Intronic
1189461948 X:41250209-41250231 TATGCAAAATTGGCCGGGCGTGG + Intergenic
1189780664 X:44511256-44511278 AATCCTGGAAAGGCCGGGCGAGG - Intergenic
1189836456 X:45028101-45028123 TAAAAAGTACAGGCCGGGCGTGG - Intronic
1190835645 X:54098329-54098351 TATTCATAATAGGCCGGGCACGG - Intronic
1191849191 X:65573092-65573114 TTTCCAAAACAGGCTGGGTGCGG + Intergenic
1192175292 X:68881241-68881263 TATGGAGAACAGGCTGGGGGAGG + Intergenic
1192366137 X:70475038-70475060 TATACAGTGCAGGCCGGGCATGG + Intronic
1192487676 X:71544074-71544096 TATATATATCAGGCCGGGCGTGG - Intronic
1192495490 X:71614270-71614292 AAGGCAGAAAAGGCCGGGCGAGG - Intergenic
1193619311 X:83731861-83731883 CATTCAAAATAGGCCGGGCGCGG - Intergenic
1193762173 X:85480649-85480671 TAGCCAAAATAGGCCGGGCACGG + Intergenic
1194011924 X:88572528-88572550 TAACTACAACTGGCCGGGCGCGG + Intergenic
1194199511 X:90937698-90937720 TATAAAGGACAGGCCGGGCACGG + Intergenic
1194305003 X:92233003-92233025 TATTTAGGGCAGGCCGGGCGCGG - Intronic
1194815134 X:98431733-98431755 CAACAACAACAGGCCGGGCGCGG - Intergenic
1195028149 X:100899222-100899244 TACTAAGAACAGGCCGGGCGTGG + Intergenic
1195060778 X:101191716-101191738 TATCCTGGGCCGGCCGGGCGGGG - Intergenic
1195130954 X:101851640-101851662 TAAAAAGAAGAGGCCGGGCGCGG + Intronic
1195495019 X:105521232-105521254 TAGCTATAGCAGGCCGGGCGCGG - Intronic
1196106885 X:111906062-111906084 TGTCATTAACAGGCCGGGCGCGG + Intronic
1196377688 X:115052716-115052738 TTTCCTGAAGAGGCCGGGCATGG + Intergenic
1196436310 X:115677807-115677829 AAACAAGAACAGGCCAGGCGCGG + Intergenic
1196630003 X:117927275-117927297 GATCCAGGCCAGGCCGGGAGGGG - Intronic
1196780433 X:119378680-119378702 TACCTAGAAGAGGCCGGGCGCGG + Intergenic
1197194812 X:123688438-123688460 AAAGCAGATCAGGCCGGGCGTGG + Intronic
1197196653 X:123709299-123709321 TAGCCACTAGAGGCCGGGCGCGG + Intronic
1197224816 X:123946177-123946199 TAAGAAGTACAGGCCGGGCGCGG - Intergenic
1197686231 X:129442436-129442458 TACCCAATACTGGCCGGGCGTGG + Intergenic
1198245083 X:134822845-134822867 TATGTACAACAGGCCAGGCGCGG + Intronic
1198470974 X:136946741-136946763 AAGCCATACCAGGCCGGGCGTGG + Intergenic
1198831985 X:140760478-140760500 TAGCTTGAATAGGCCGGGCGCGG + Intergenic
1198973343 X:142305708-142305730 TAATAACAACAGGCCGGGCGTGG - Intergenic
1199877860 X:151949072-151949094 AATCCAGACAAGGCCGAGCGTGG - Intergenic
1200172304 X:154086210-154086232 TATATATAACAGGCTGGGCGTGG - Intronic
1200664475 Y:6003909-6003931 AATATAAAACAGGCCGGGCGCGG + Intergenic
1200829263 Y:7674521-7674543 TATCCCAATCAGGCCAGGCGTGG - Intergenic
1201983756 Y:19938803-19938825 TACATAGAATAGGCCGGGCGCGG + Intergenic