ID: 1037579108

View in Genome Browser
Species Human (GRCh38)
Location 8:20234288-20234310
Sequence CTGTTCTAAAAGCTGGGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037579108_1037579116 18 Left 1037579108 8:20234288-20234310 CCAAACCCCAGCTTTTAGAACAG No data
Right 1037579116 8:20234329-20234351 GTTGGTCTTGACTTCTCTTGTGG No data
1037579108_1037579117 29 Left 1037579108 8:20234288-20234310 CCAAACCCCAGCTTTTAGAACAG No data
Right 1037579117 8:20234340-20234362 CTTCTCTTGTGGAGAAGCTCTGG No data
1037579108_1037579113 0 Left 1037579108 8:20234288-20234310 CCAAACCCCAGCTTTTAGAACAG No data
Right 1037579113 8:20234311-20234333 AATCCTCCTGTTTATGGTGTTGG No data
1037579108_1037579112 -6 Left 1037579108 8:20234288-20234310 CCAAACCCCAGCTTTTAGAACAG No data
Right 1037579112 8:20234305-20234327 GAACAGAATCCTCCTGTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037579108 Original CRISPR CTGTTCTAAAAGCTGGGGTT TGG (reversed) Intergenic
No off target data available for this crispr