ID: 1037590597

View in Genome Browser
Species Human (GRCh38)
Location 8:20308849-20308871
Sequence GGGCAGTGTTGACCACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037590596_1037590597 -4 Left 1037590596 8:20308830-20308852 CCTGAATGTGGTTTGATCTGGGC No data
Right 1037590597 8:20308849-20308871 GGGCAGTGTTGACCACAAGCAGG No data
1037590589_1037590597 24 Left 1037590589 8:20308802-20308824 CCTCAGAAACCTTGTAACTGACA No data
Right 1037590597 8:20308849-20308871 GGGCAGTGTTGACCACAAGCAGG No data
1037590588_1037590597 28 Left 1037590588 8:20308798-20308820 CCTGCCTCAGAAACCTTGTAACT No data
Right 1037590597 8:20308849-20308871 GGGCAGTGTTGACCACAAGCAGG No data
1037590592_1037590597 15 Left 1037590592 8:20308811-20308833 CCTTGTAACTGACACAGGGCCTG No data
Right 1037590597 8:20308849-20308871 GGGCAGTGTTGACCACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037590597 Original CRISPR GGGCAGTGTTGACCACAAGC AGG Intergenic
No off target data available for this crispr