ID: 1037593049

View in Genome Browser
Species Human (GRCh38)
Location 8:20329464-20329486
Sequence CCCTTCTTTGTCATCGTCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037593046_1037593049 20 Left 1037593046 8:20329421-20329443 CCAGGGTCATGGTATTCACAGCG No data
Right 1037593049 8:20329464-20329486 CCCTTCTTTGTCATCGTCGGAGG No data
1037593045_1037593049 23 Left 1037593045 8:20329418-20329440 CCACCAGGGTCATGGTATTCACA No data
Right 1037593049 8:20329464-20329486 CCCTTCTTTGTCATCGTCGGAGG No data
1037593044_1037593049 24 Left 1037593044 8:20329417-20329439 CCCACCAGGGTCATGGTATTCAC No data
Right 1037593049 8:20329464-20329486 CCCTTCTTTGTCATCGTCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037593049 Original CRISPR CCCTTCTTTGTCATCGTCGG AGG Intergenic
No off target data available for this crispr