ID: 1037593521

View in Genome Browser
Species Human (GRCh38)
Location 8:20333979-20334001
Sequence ACGCACTCACCACTCACTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037593518_1037593521 -10 Left 1037593518 8:20333966-20333988 CCTGGGCCTCCACACGCACTCAC No data
Right 1037593521 8:20333979-20334001 ACGCACTCACCACTCACTCATGG No data
1037593517_1037593521 -9 Left 1037593517 8:20333965-20333987 CCCTGGGCCTCCACACGCACTCA No data
Right 1037593521 8:20333979-20334001 ACGCACTCACCACTCACTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037593521 Original CRISPR ACGCACTCACCACTCACTCA TGG Intergenic
No off target data available for this crispr