ID: 1037595230

View in Genome Browser
Species Human (GRCh38)
Location 8:20349225-20349247
Sequence AATTGAGCAGGCAGTGCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037595230_1037595232 -10 Left 1037595230 8:20349225-20349247 CCTGAGGCACTGCCTGCTCAATT No data
Right 1037595232 8:20349238-20349260 CTGCTCAATTCTCAGAGTTCAGG No data
1037595230_1037595241 28 Left 1037595230 8:20349225-20349247 CCTGAGGCACTGCCTGCTCAATT No data
Right 1037595241 8:20349276-20349298 TCAGCCCTTGATTTGTGGGGGGG No data
1037595230_1037595237 24 Left 1037595230 8:20349225-20349247 CCTGAGGCACTGCCTGCTCAATT No data
Right 1037595237 8:20349272-20349294 CTCGTCAGCCCTTGATTTGTGGG No data
1037595230_1037595240 27 Left 1037595230 8:20349225-20349247 CCTGAGGCACTGCCTGCTCAATT No data
Right 1037595240 8:20349275-20349297 GTCAGCCCTTGATTTGTGGGGGG No data
1037595230_1037595233 -1 Left 1037595230 8:20349225-20349247 CCTGAGGCACTGCCTGCTCAATT No data
Right 1037595233 8:20349247-20349269 TCTCAGAGTTCAGGCACAGATGG No data
1037595230_1037595236 23 Left 1037595230 8:20349225-20349247 CCTGAGGCACTGCCTGCTCAATT No data
Right 1037595236 8:20349271-20349293 CCTCGTCAGCCCTTGATTTGTGG No data
1037595230_1037595238 25 Left 1037595230 8:20349225-20349247 CCTGAGGCACTGCCTGCTCAATT No data
Right 1037595238 8:20349273-20349295 TCGTCAGCCCTTGATTTGTGGGG No data
1037595230_1037595239 26 Left 1037595230 8:20349225-20349247 CCTGAGGCACTGCCTGCTCAATT No data
Right 1037595239 8:20349274-20349296 CGTCAGCCCTTGATTTGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037595230 Original CRISPR AATTGAGCAGGCAGTGCCTC AGG (reversed) Intergenic