ID: 1037595231

View in Genome Browser
Species Human (GRCh38)
Location 8:20349237-20349259
Sequence CTGAACTCTGAGAATTGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037595231_1037595244 21 Left 1037595231 8:20349237-20349259 CCTGCTCAATTCTCAGAGTTCAG No data
Right 1037595244 8:20349281-20349303 CCTTGATTTGTGGGGGGGCACGG No data
1037595231_1037595241 16 Left 1037595231 8:20349237-20349259 CCTGCTCAATTCTCAGAGTTCAG No data
Right 1037595241 8:20349276-20349298 TCAGCCCTTGATTTGTGGGGGGG No data
1037595231_1037595240 15 Left 1037595231 8:20349237-20349259 CCTGCTCAATTCTCAGAGTTCAG No data
Right 1037595240 8:20349275-20349297 GTCAGCCCTTGATTTGTGGGGGG No data
1037595231_1037595237 12 Left 1037595231 8:20349237-20349259 CCTGCTCAATTCTCAGAGTTCAG No data
Right 1037595237 8:20349272-20349294 CTCGTCAGCCCTTGATTTGTGGG No data
1037595231_1037595236 11 Left 1037595231 8:20349237-20349259 CCTGCTCAATTCTCAGAGTTCAG No data
Right 1037595236 8:20349271-20349293 CCTCGTCAGCCCTTGATTTGTGG No data
1037595231_1037595238 13 Left 1037595231 8:20349237-20349259 CCTGCTCAATTCTCAGAGTTCAG No data
Right 1037595238 8:20349273-20349295 TCGTCAGCCCTTGATTTGTGGGG No data
1037595231_1037595239 14 Left 1037595231 8:20349237-20349259 CCTGCTCAATTCTCAGAGTTCAG No data
Right 1037595239 8:20349274-20349296 CGTCAGCCCTTGATTTGTGGGGG No data
1037595231_1037595245 22 Left 1037595231 8:20349237-20349259 CCTGCTCAATTCTCAGAGTTCAG No data
Right 1037595245 8:20349282-20349304 CTTGATTTGTGGGGGGGCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037595231 Original CRISPR CTGAACTCTGAGAATTGAGC AGG (reversed) Intergenic