ID: 1037595232

View in Genome Browser
Species Human (GRCh38)
Location 8:20349238-20349260
Sequence CTGCTCAATTCTCAGAGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037595229_1037595232 -2 Left 1037595229 8:20349217-20349239 CCTGGAGGCCTGAGGCACTGCCT No data
Right 1037595232 8:20349238-20349260 CTGCTCAATTCTCAGAGTTCAGG No data
1037595230_1037595232 -10 Left 1037595230 8:20349225-20349247 CCTGAGGCACTGCCTGCTCAATT No data
Right 1037595232 8:20349238-20349260 CTGCTCAATTCTCAGAGTTCAGG No data
1037595223_1037595232 16 Left 1037595223 8:20349199-20349221 CCTTACAGCTTGGAGGCCCCTGG No data
Right 1037595232 8:20349238-20349260 CTGCTCAATTCTCAGAGTTCAGG No data
1037595228_1037595232 -1 Left 1037595228 8:20349216-20349238 CCCTGGAGGCCTGAGGCACTGCC No data
Right 1037595232 8:20349238-20349260 CTGCTCAATTCTCAGAGTTCAGG No data
1037595227_1037595232 0 Left 1037595227 8:20349215-20349237 CCCCTGGAGGCCTGAGGCACTGC No data
Right 1037595232 8:20349238-20349260 CTGCTCAATTCTCAGAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037595232 Original CRISPR CTGCTCAATTCTCAGAGTTC AGG Intergenic