ID: 1037595239 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:20349274-20349296 |
Sequence | CGTCAGCCCTTGATTTGTGG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1037595231_1037595239 | 14 | Left | 1037595231 | 8:20349237-20349259 | CCTGCTCAATTCTCAGAGTTCAG | No data | ||
Right | 1037595239 | 8:20349274-20349296 | CGTCAGCCCTTGATTTGTGGGGG | No data | ||||
1037595230_1037595239 | 26 | Left | 1037595230 | 8:20349225-20349247 | CCTGAGGCACTGCCTGCTCAATT | No data | ||
Right | 1037595239 | 8:20349274-20349296 | CGTCAGCCCTTGATTTGTGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1037595239 | Original CRISPR | CGTCAGCCCTTGATTTGTGG GGG | Intergenic | ||