ID: 1037595240

View in Genome Browser
Species Human (GRCh38)
Location 8:20349275-20349297
Sequence GTCAGCCCTTGATTTGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037595230_1037595240 27 Left 1037595230 8:20349225-20349247 CCTGAGGCACTGCCTGCTCAATT No data
Right 1037595240 8:20349275-20349297 GTCAGCCCTTGATTTGTGGGGGG No data
1037595231_1037595240 15 Left 1037595231 8:20349237-20349259 CCTGCTCAATTCTCAGAGTTCAG No data
Right 1037595240 8:20349275-20349297 GTCAGCCCTTGATTTGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037595240 Original CRISPR GTCAGCCCTTGATTTGTGGG GGG Intergenic