ID: 1037595245

View in Genome Browser
Species Human (GRCh38)
Location 8:20349282-20349304
Sequence CTTGATTTGTGGGGGGGCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037595231_1037595245 22 Left 1037595231 8:20349237-20349259 CCTGCTCAATTCTCAGAGTTCAG No data
Right 1037595245 8:20349282-20349304 CTTGATTTGTGGGGGGGCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037595245 Original CRISPR CTTGATTTGTGGGGGGGCAC GGG Intergenic