ID: 1037598202

View in Genome Browser
Species Human (GRCh38)
Location 8:20372312-20372334
Sequence GCAGTTCCACACTCTGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037598200_1037598202 27 Left 1037598200 8:20372262-20372284 CCAAAGCTCGGTAGCTTAAAACA No data
Right 1037598202 8:20372312-20372334 GCAGTTCCACACTCTGAGCAGGG No data
1037598199_1037598202 28 Left 1037598199 8:20372261-20372283 CCCAAAGCTCGGTAGCTTAAAAC No data
Right 1037598202 8:20372312-20372334 GCAGTTCCACACTCTGAGCAGGG No data
1037598198_1037598202 29 Left 1037598198 8:20372260-20372282 CCCCAAAGCTCGGTAGCTTAAAA No data
Right 1037598202 8:20372312-20372334 GCAGTTCCACACTCTGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037598202 Original CRISPR GCAGTTCCACACTCTGAGCA GGG Intergenic
No off target data available for this crispr