ID: 1037598595

View in Genome Browser
Species Human (GRCh38)
Location 8:20374659-20374681
Sequence GAGAGCAGGGAGAAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037598595_1037598605 17 Left 1037598595 8:20374659-20374681 CCTGCCTCCTTCTCCCTGCTCTC No data
Right 1037598605 8:20374699-20374721 CCAGCTCCCACAATCCCCTTTGG No data
1037598595_1037598611 27 Left 1037598595 8:20374659-20374681 CCTGCCTCCTTCTCCCTGCTCTC No data
Right 1037598611 8:20374709-20374731 CAATCCCCTTTGGCCACTGGGGG No data
1037598595_1037598610 26 Left 1037598595 8:20374659-20374681 CCTGCCTCCTTCTCCCTGCTCTC No data
Right 1037598610 8:20374708-20374730 ACAATCCCCTTTGGCCACTGGGG No data
1037598595_1037598608 24 Left 1037598595 8:20374659-20374681 CCTGCCTCCTTCTCCCTGCTCTC No data
Right 1037598608 8:20374706-20374728 CCACAATCCCCTTTGGCCACTGG No data
1037598595_1037598609 25 Left 1037598595 8:20374659-20374681 CCTGCCTCCTTCTCCCTGCTCTC No data
Right 1037598609 8:20374707-20374729 CACAATCCCCTTTGGCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037598595 Original CRISPR GAGAGCAGGGAGAAGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr