ID: 1037602741

View in Genome Browser
Species Human (GRCh38)
Location 8:20411768-20411790
Sequence CTGTAAACTCATAATGAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037602741_1037602745 -7 Left 1037602741 8:20411768-20411790 CCGTGTTCATTATGAGTTTACAG No data
Right 1037602745 8:20411784-20411806 TTTACAGTTATGCTGGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037602741 Original CRISPR CTGTAAACTCATAATGAACA CGG (reversed) Intergenic
No off target data available for this crispr