ID: 1037602807

View in Genome Browser
Species Human (GRCh38)
Location 8:20412328-20412350
Sequence CAAACTACTCCCAAACTTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037602806_1037602807 -1 Left 1037602806 8:20412306-20412328 CCAGTTATCTATGGCTGTGTAAC No data
Right 1037602807 8:20412328-20412350 CAAACTACTCCCAAACTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037602807 Original CRISPR CAAACTACTCCCAAACTTAG TGG Intergenic
No off target data available for this crispr