ID: 1037608516

View in Genome Browser
Species Human (GRCh38)
Location 8:20457392-20457414
Sequence GCTTTTGGGCAGCCAGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037608516_1037608524 2 Left 1037608516 8:20457392-20457414 CCAACTCCTGGCTGCCCAAAAGC No data
Right 1037608524 8:20457417-20457439 CAGGCTGTTCTGTAAGTGGAGGG No data
1037608516_1037608523 1 Left 1037608516 8:20457392-20457414 CCAACTCCTGGCTGCCCAAAAGC No data
Right 1037608523 8:20457416-20457438 CCAGGCTGTTCTGTAAGTGGAGG No data
1037608516_1037608521 -2 Left 1037608516 8:20457392-20457414 CCAACTCCTGGCTGCCCAAAAGC No data
Right 1037608521 8:20457413-20457435 GCACCAGGCTGTTCTGTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037608516 Original CRISPR GCTTTTGGGCAGCCAGGAGT TGG (reversed) Intergenic
No off target data available for this crispr