ID: 1037609162

View in Genome Browser
Species Human (GRCh38)
Location 8:20462003-20462025
Sequence CCCTAGGACCGGTGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037609153_1037609162 -7 Left 1037609153 8:20461987-20462009 CCCCAAGGAGACTGCACCCTAGG No data
Right 1037609162 8:20462003-20462025 CCCTAGGACCGGTGGGAAGTGGG No data
1037609155_1037609162 -8 Left 1037609155 8:20461988-20462010 CCCAAGGAGACTGCACCCTAGGA No data
Right 1037609162 8:20462003-20462025 CCCTAGGACCGGTGGGAAGTGGG No data
1037609151_1037609162 10 Left 1037609151 8:20461970-20461992 CCTGGGCGTCAAAGGAACCCCAA No data
Right 1037609162 8:20462003-20462025 CCCTAGGACCGGTGGGAAGTGGG No data
1037609156_1037609162 -9 Left 1037609156 8:20461989-20462011 CCAAGGAGACTGCACCCTAGGAC No data
Right 1037609162 8:20462003-20462025 CCCTAGGACCGGTGGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037609162 Original CRISPR CCCTAGGACCGGTGGGAAGT GGG Intergenic
No off target data available for this crispr