ID: 1037609336

View in Genome Browser
Species Human (GRCh38)
Location 8:20463350-20463372
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037609336_1037609350 21 Left 1037609336 8:20463350-20463372 CCACTGTTTGACTTGCAGCTTTT No data
Right 1037609350 8:20463394-20463416 AGAGTGGGGTGAGGCAGAGGAGG No data
1037609336_1037609346 6 Left 1037609336 8:20463350-20463372 CCACTGTTTGACTTGCAGCTTTT No data
Right 1037609346 8:20463379-20463401 GGAACTTCACTGGGGAGAGTGGG No data
1037609336_1037609345 5 Left 1037609336 8:20463350-20463372 CCACTGTTTGACTTGCAGCTTTT No data
Right 1037609345 8:20463378-20463400 GGGAACTTCACTGGGGAGAGTGG No data
1037609336_1037609348 12 Left 1037609336 8:20463350-20463372 CCACTGTTTGACTTGCAGCTTTT No data
Right 1037609348 8:20463385-20463407 TCACTGGGGAGAGTGGGGTGAGG No data
1037609336_1037609344 -2 Left 1037609336 8:20463350-20463372 CCACTGTTTGACTTGCAGCTTTT No data
Right 1037609344 8:20463371-20463393 TTGGGGAGGGAACTTCACTGGGG No data
1037609336_1037609342 -4 Left 1037609336 8:20463350-20463372 CCACTGTTTGACTTGCAGCTTTT No data
Right 1037609342 8:20463369-20463391 TTTTGGGGAGGGAACTTCACTGG No data
1037609336_1037609343 -3 Left 1037609336 8:20463350-20463372 CCACTGTTTGACTTGCAGCTTTT No data
Right 1037609343 8:20463370-20463392 TTTGGGGAGGGAACTTCACTGGG No data
1037609336_1037609349 18 Left 1037609336 8:20463350-20463372 CCACTGTTTGACTTGCAGCTTTT No data
Right 1037609349 8:20463391-20463413 GGGAGAGTGGGGTGAGGCAGAGG No data
1037609336_1037609347 7 Left 1037609336 8:20463350-20463372 CCACTGTTTGACTTGCAGCTTTT No data
Right 1037609347 8:20463380-20463402 GAACTTCACTGGGGAGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037609336 Original CRISPR AAAAGCTGCAAGTCAAACAG TGG (reversed) Intergenic