ID: 1037609345

View in Genome Browser
Species Human (GRCh38)
Location 8:20463378-20463400
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037609336_1037609345 5 Left 1037609336 8:20463350-20463372 CCACTGTTTGACTTGCAGCTTTT No data
Right 1037609345 8:20463378-20463400 GGGAACTTCACTGGGGAGAGTGG No data
1037609333_1037609345 8 Left 1037609333 8:20463347-20463369 CCCCCACTGTTTGACTTGCAGCT No data
Right 1037609345 8:20463378-20463400 GGGAACTTCACTGGGGAGAGTGG No data
1037609335_1037609345 6 Left 1037609335 8:20463349-20463371 CCCACTGTTTGACTTGCAGCTTT No data
Right 1037609345 8:20463378-20463400 GGGAACTTCACTGGGGAGAGTGG No data
1037609334_1037609345 7 Left 1037609334 8:20463348-20463370 CCCCACTGTTTGACTTGCAGCTT No data
Right 1037609345 8:20463378-20463400 GGGAACTTCACTGGGGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037609345 Original CRISPR GGGAACTTCACTGGGGAGAG TGG Intergenic