ID: 1037615502

View in Genome Browser
Species Human (GRCh38)
Location 8:20515339-20515361
Sequence ACTAAGTATCCATATGGTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037615498_1037615502 2 Left 1037615498 8:20515314-20515336 CCTGGGTTCAAATCCTGCCTGTA No data
Right 1037615502 8:20515339-20515361 ACTAAGTATCCATATGGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037615502 Original CRISPR ACTAAGTATCCATATGGTTT TGG Intergenic
No off target data available for this crispr