ID: 1037619574

View in Genome Browser
Species Human (GRCh38)
Location 8:20551524-20551546
Sequence CCGTGGGTTTCACTCTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037619566_1037619574 11 Left 1037619566 8:20551490-20551512 CCTCCCAGACCACTGGGATGGGT No data
Right 1037619574 8:20551524-20551546 CCGTGGGTTTCACTCTCAGGAGG No data
1037619568_1037619574 7 Left 1037619568 8:20551494-20551516 CCAGACCACTGGGATGGGTGAAA No data
Right 1037619574 8:20551524-20551546 CCGTGGGTTTCACTCTCAGGAGG No data
1037619564_1037619574 12 Left 1037619564 8:20551489-20551511 CCCTCCCAGACCACTGGGATGGG No data
Right 1037619574 8:20551524-20551546 CCGTGGGTTTCACTCTCAGGAGG No data
1037619562_1037619574 13 Left 1037619562 8:20551488-20551510 CCCCTCCCAGACCACTGGGATGG No data
Right 1037619574 8:20551524-20551546 CCGTGGGTTTCACTCTCAGGAGG No data
1037619567_1037619574 8 Left 1037619567 8:20551493-20551515 CCCAGACCACTGGGATGGGTGAA No data
Right 1037619574 8:20551524-20551546 CCGTGGGTTTCACTCTCAGGAGG No data
1037619569_1037619574 2 Left 1037619569 8:20551499-20551521 CCACTGGGATGGGTGAAAGAAAG No data
Right 1037619574 8:20551524-20551546 CCGTGGGTTTCACTCTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037619574 Original CRISPR CCGTGGGTTTCACTCTCAGG AGG Intergenic
No off target data available for this crispr