ID: 1037620148

View in Genome Browser
Species Human (GRCh38)
Location 8:20556294-20556316
Sequence CTGTGGACATTGTGAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037620143_1037620148 1 Left 1037620143 8:20556270-20556292 CCTGACCTCTTCTCCATGGGTTA No data
Right 1037620148 8:20556294-20556316 CTGTGGACATTGTGAGCAGAGGG No data
1037620140_1037620148 7 Left 1037620140 8:20556264-20556286 CCTGTACCTGACCTCTTCTCCAT No data
Right 1037620148 8:20556294-20556316 CTGTGGACATTGTGAGCAGAGGG No data
1037620138_1037620148 18 Left 1037620138 8:20556253-20556275 CCTCTGCTTACCCTGTACCTGAC No data
Right 1037620148 8:20556294-20556316 CTGTGGACATTGTGAGCAGAGGG No data
1037620139_1037620148 8 Left 1037620139 8:20556263-20556285 CCCTGTACCTGACCTCTTCTCCA No data
Right 1037620148 8:20556294-20556316 CTGTGGACATTGTGAGCAGAGGG No data
1037620144_1037620148 -4 Left 1037620144 8:20556275-20556297 CCTCTTCTCCATGGGTTAGCTGT No data
Right 1037620148 8:20556294-20556316 CTGTGGACATTGTGAGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037620148 Original CRISPR CTGTGGACATTGTGAGCAGA GGG Intergenic
No off target data available for this crispr