ID: 1037620160

View in Genome Browser
Species Human (GRCh38)
Location 8:20556363-20556385
Sequence CTGTGGACATTGTGAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037620150_1037620160 8 Left 1037620150 8:20556332-20556354 CCCTGTACCTGACCTCTTCTCCA No data
Right 1037620160 8:20556363-20556385 CTGTGGACATTGTGAGCAGAGGG No data
1037620149_1037620160 18 Left 1037620149 8:20556322-20556344 CCTCTGCTTACCCTGTACCTGAC No data
Right 1037620160 8:20556363-20556385 CTGTGGACATTGTGAGCAGAGGG No data
1037620151_1037620160 7 Left 1037620151 8:20556333-20556355 CCTGTACCTGACCTCTTCTCCAT No data
Right 1037620160 8:20556363-20556385 CTGTGGACATTGTGAGCAGAGGG No data
1037620156_1037620160 -4 Left 1037620156 8:20556344-20556366 CCTCTTCTCCATGGGTTGGCTGT No data
Right 1037620160 8:20556363-20556385 CTGTGGACATTGTGAGCAGAGGG No data
1037620154_1037620160 1 Left 1037620154 8:20556339-20556361 CCTGACCTCTTCTCCATGGGTTG No data
Right 1037620160 8:20556363-20556385 CTGTGGACATTGTGAGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037620160 Original CRISPR CTGTGGACATTGTGAGCAGA GGG Intergenic
No off target data available for this crispr