ID: 1037620348

View in Genome Browser
Species Human (GRCh38)
Location 8:20558160-20558182
Sequence CAGTGTGGCTGGAGCACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 877
Summary {0: 3, 1: 9, 2: 39, 3: 149, 4: 677}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037620348_1037620355 16 Left 1037620348 8:20558160-20558182 CCTTCTGTGCTCCAGCCACACTG 0: 3
1: 9
2: 39
3: 149
4: 677
Right 1037620355 8:20558199-20558221 TAAACATGCCCTGTGTTTCCTGG No data
1037620348_1037620359 27 Left 1037620348 8:20558160-20558182 CCTTCTGTGCTCCAGCCACACTG 0: 3
1: 9
2: 39
3: 149
4: 677
Right 1037620359 8:20558210-20558232 TGTGTTTCCTGGATGAGGCCAGG No data
1037620348_1037620356 22 Left 1037620348 8:20558160-20558182 CCTTCTGTGCTCCAGCCACACTG 0: 3
1: 9
2: 39
3: 149
4: 677
Right 1037620356 8:20558205-20558227 TGCCCTGTGTTTCCTGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037620348 Original CRISPR CAGTGTGGCTGGAGCACAGA AGG (reversed) Intergenic
900331550 1:2137276-2137298 CAGTGCGGCTGGGGCAAAGCAGG - Intronic
900482372 1:2905418-2905440 CTGGGGGGCTGGAGCACAGAGGG - Intergenic
900615972 1:3565812-3565834 GAGCGTGGCTGGAGCAGAGTTGG - Intronic
900998500 1:6135577-6135599 CAGTGTGGCTGAGGAAAAGAGGG - Intronic
901009004 1:6188087-6188109 CAGTGAGCCTGGGCCACAGAAGG - Intronic
901155627 1:7136022-7136044 CAGTGTGGCTGGAGAAAAACAGG + Intronic
901155812 1:7137450-7137472 CAGTGTGGCTGGAGAAAAACAGG + Intronic
901167308 1:7229693-7229715 CTGTGAGCCAGGAGCACAGAGGG + Intronic
901245833 1:7730319-7730341 CCGTGTGGCTGGAGCACAGAGGG - Intronic
901376185 1:8841191-8841213 CAATGAGGCTGGAGAACAGTGGG - Intergenic
901671221 1:10857362-10857384 CAGTGTGTCTTGTGCACCGACGG + Intergenic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
901864357 1:12094419-12094441 CAGTGTGGCTAGAGATCAGAGGG + Intronic
902079673 1:13812526-13812548 CAGTGTGGCTGGAGCCTGGTAGG + Intronic
902097511 1:13958807-13958829 CAATGTGGCTGGAGCCAAGGCGG + Intergenic
902200462 1:14829763-14829785 TAGTGTGGCCAGAGCATAGAAGG + Intronic
902242595 1:15098977-15098999 CAATGTGACTGGTGCAGAGATGG + Intronic
902628850 1:17692822-17692844 CAGTGCACCTGGGGCACAGAAGG - Intronic
902662531 1:17915083-17915105 CAGAGTAGCTAGAGCACTGAAGG + Intergenic
902706190 1:18206650-18206672 CAATGTAGCTGGAGCAGAGTGGG + Intronic
902878461 1:19355040-19355062 CAGAGGGGCTGGAGGCCAGAAGG - Intronic
903320560 1:22540658-22540680 CAGGGTGGCTGGAGCAGAGTGGG + Intergenic
903478159 1:23634664-23634686 CAGTGTGGCTGGAACCCAGCTGG + Intronic
903568387 1:24285869-24285891 CACGGTGCCTGGAGCACAGTGGG - Intergenic
903757776 1:25674711-25674733 TAGTGTGGCTGTGGCAGAGATGG + Intronic
903781223 1:25821031-25821053 CAGTGTGGCTGGAGGGCAAGGGG + Intronic
903864064 1:26385223-26385245 GAGGGTGGCTGGAGCCCGGAAGG + Intergenic
904076443 1:27846307-27846329 CAGTGTTTCTGGAGCACAGAGGG - Intronic
904213008 1:28898107-28898129 TGGTGTGGCTGGAGCACAAAGGG + Intronic
904424388 1:30414186-30414208 CTGTGTGGTTGGAGCATAGGAGG + Intergenic
904439179 1:30518628-30518650 CAGCATGGATGGAGCCCAGATGG + Intergenic
905127254 1:35724358-35724380 CAGTGTGGCTGGAGCTCGGTGGG + Intronic
905151297 1:35930420-35930442 CAGTATAGCTGTAGCACAGGCGG + Intergenic
905728293 1:40274551-40274573 CAGTGTGGCTGCACCATAGCAGG + Intronic
906527436 1:46503089-46503111 CAGGGTGGCTGGAGCACAGATGG - Intergenic
906656513 1:47552284-47552306 CCTTGTGGCTGGAGCACAGTGGG - Intergenic
906827212 1:48994140-48994162 CACTGTGGCTGGAATACAGGTGG - Intronic
907281548 1:53350293-53350315 CAGTGTGGCTGGAGCATGGTGGG - Intergenic
907313599 1:53553837-53553859 CTGTGTGGCTGGAGCAGAACGGG + Intronic
907470767 1:54672055-54672077 CAGTGTGACTGGAGCCCAGAGGG + Intronic
908141086 1:61185667-61185689 CAGTATGGCTGGAGCATCTAAGG - Intronic
908389924 1:63675197-63675219 CACTGTGCCTGGAGCATAGTGGG + Intergenic
909119171 1:71579209-71579231 CCATGTGACTGGAACACAGAGGG - Intronic
909502644 1:76353175-76353197 CAGGGTGGCTGGAGAGGAGATGG - Intronic
910092479 1:83481372-83481394 CTGCGTGGCTGGAGCAGAGTAGG - Intergenic
911463738 1:98224210-98224232 CAGTGTGGCTGAAGCATAAAAGG + Intergenic
911770566 1:101735659-101735681 CAGTGCTGCTGGAGCATAAAGGG + Intergenic
911807007 1:102222964-102222986 CAGTGTGGCTAGAGTAAAGCAGG + Intergenic
912207342 1:107523218-107523240 CTGTGTGGCTGGAGCAGAACAGG - Intergenic
912230632 1:107788404-107788426 GAGTCTGTCTGGAGCACAGCAGG - Intronic
912713470 1:111965895-111965917 CAGAGTGCCTGGCACACAGAGGG - Intronic
912987320 1:114447001-114447023 CAGTGTAGCTGTAGCAGAGATGG + Intronic
913362291 1:117995063-117995085 CAAAGTAGCTGAAGCACAGAGGG - Intronic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
915113303 1:153578575-153578597 CAGTGTGGCTGGAGCATGGATGG + Intergenic
915744994 1:158149186-158149208 CAGTGTGGATGGAGAAAAGTGGG + Intergenic
915841535 1:159217098-159217120 GAGTCTGGCTGGAGCCCAGGAGG - Intergenic
915905411 1:159873284-159873306 AAATGGGGCTGGAGCCCAGAGGG - Intronic
916486758 1:165266393-165266415 CAGTGTGGCTGGGGCAAAGATGG + Intronic
916623162 1:166523986-166524008 CAGTGTGGCTGGTGCAGTGGAGG + Intergenic
916665538 1:166963714-166963736 CAGTATGGCTGGAGCATACTGGG - Intronic
916911663 1:169355534-169355556 CAGTGTAACTGGAGCAGAGAAGG - Intronic
917112593 1:171565150-171565172 CAGTGAGGCTGAAGCATAGCAGG - Intronic
917447797 1:175121368-175121390 CAGTTTTGCTGGAGCATAGAGGG + Intronic
917468610 1:175306896-175306918 CAGAGTGGCTGAAGCACAGATGG - Intergenic
919784280 1:201249332-201249354 CAGTGGGGCTGGAACAAAGGTGG - Intergenic
919885163 1:201928361-201928383 TAGTGAGGCTGGAGCAAAGGAGG - Intronic
920185229 1:204155283-204155305 CAGTGTGGCTAGGGGAGAGATGG - Intronic
920193565 1:204211364-204211386 CAGTGTGGTTGGAGCATGGCAGG - Intronic
920244908 1:204580123-204580145 CAGTGAGAGGGGAGCACAGAGGG - Intergenic
920364699 1:205441923-205441945 CAGTCTGGCTGGGGAAGAGAGGG + Intronic
920541254 1:206779786-206779808 CAATGAGGCTGGAGTGCAGAGGG - Intergenic
920768693 1:208858952-208858974 CAGTGTGGTTGGAGTAAAGTGGG + Intergenic
920805024 1:209224872-209224894 CAGTGTGGTTGGAGCACAGAGGG - Intergenic
920834189 1:209492868-209492890 CAGTGTAGCTAGAGCTCAGTGGG + Intergenic
920977155 1:210797016-210797038 TAGTGTGGCTGGAACACAAGAGG - Intronic
921056688 1:211547976-211547998 CAGTGTGGCTGAAACAGAGTGGG - Intergenic
922227632 1:223659371-223659393 CAGTGGGGCCAGATCACAGAGGG - Intronic
922896660 1:229106053-229106075 CAGTGTGGCTCAAGGACAGGAGG + Intergenic
923082542 1:230672372-230672394 CTGTGTGGCTGGAGCATCCAGGG - Intronic
923333352 1:232946177-232946199 CAGTGTGGCCGGAGCAGAGTAGG - Intergenic
923888940 1:238189674-238189696 CAATGTGGATGGAGAACCGAGGG - Intergenic
923958639 1:239051776-239051798 CAGTGTGGTTGGGGCAGAGTTGG + Intergenic
924597855 1:245463052-245463074 AAGTGTGGGTGGAGGACAGAGGG - Intronic
924924112 1:248661707-248661729 CAGGATGGCTGGAGCAGTGAGGG + Intergenic
1063207970 10:3853132-3853154 CTGGGTGGCGGGAGCTCAGAGGG + Intergenic
1063785723 10:9380621-9380643 CAGCGTGGCTGGAACAAAGCAGG + Intergenic
1064367057 10:14717638-14717660 CAGTGTGGCTAGAACAAAGCAGG - Intronic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065052283 10:21807351-21807373 CAGTGTGGTTAGAGCACAGTGGG - Intronic
1065145591 10:22764553-22764575 TGGTGTGGATGGAGCCCAGAGGG + Intergenic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1065853985 10:29814893-29814915 TGGTGTGGCTGGAGCTCAGATGG + Intergenic
1066981682 10:42422463-42422485 CAGTGTAGCTGAAGGAGAGATGG - Intergenic
1067073869 10:43161517-43161539 CAGTGTACCTGGAACACAGTAGG - Intronic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1067452196 10:46388672-46388694 CAGTGTGGCTGGATCCCAAGGGG + Intronic
1067585041 10:47471083-47471105 CAGTGTGGCTGGATCCCAAGGGG - Intronic
1067684509 10:48458474-48458496 CAGTGTGGGTGAGGCGCAGACGG + Intronic
1067687479 10:48475899-48475921 CAGTGTGGCCAGAGCAGAGTGGG - Intronic
1068280704 10:54865212-54865234 CAGTGTGGCTAGAACAAAGCAGG + Intronic
1069377849 10:67812236-67812258 CAGTGTGGCTGGAGGACACAAGG + Intronic
1069507986 10:69018841-69018863 CAGTGTGGCTGGAGCAGATAAGG + Intergenic
1069799419 10:71072885-71072907 CAGAGTGCCTGGAGCAAAGCCGG + Intergenic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1070690984 10:78525239-78525261 CAGTGCCGCTGTAGCACAAAAGG - Intergenic
1070917675 10:80165291-80165313 GAGTCAGGCTGGAGCCCAGAAGG - Intronic
1071450530 10:85788485-85788507 CAATGTGGCTGGCCCACAGTGGG + Intronic
1071548558 10:86547759-86547781 CAGGATGGCTTGAGCCCAGAAGG + Intergenic
1071876155 10:89845457-89845479 CTGTGTGGCTGGAACACAGGTGG + Intergenic
1072210948 10:93246670-93246692 CAGTGTGTCTGGGGCAGAGGTGG + Intergenic
1072802889 10:98405505-98405527 CACAGTGCCTGGTGCACAGAGGG - Intronic
1072867194 10:99076475-99076497 CAGAATTGCTTGAGCACAGAAGG - Intronic
1073957442 10:108889661-108889683 CAGTGCGGCTGGAACAAAGCAGG - Intergenic
1074904540 10:117849865-117849887 TAGTGTGGGTGGAGCAGGGATGG + Intergenic
1075259127 10:120947911-120947933 CCGTGTGGCTGGAGCAAAAAAGG - Intergenic
1075383384 10:122037208-122037230 CGGTGTGGCTGGAGAAAAGTGGG + Intronic
1075840930 10:125502529-125502551 CAGCATGGCAGGGGCACAGATGG - Intergenic
1075902219 10:126052117-126052139 CTGTGAGGATGGAGCACAGGAGG - Intronic
1076057465 10:127387216-127387238 CAGTGTGGCTGGAATGCAGAGGG - Intronic
1076433779 10:130425814-130425836 CAGTGTGGTAGGGTCACAGAGGG + Intergenic
1077197301 11:1287857-1287879 CAGGGAGGCTGCAGCAGAGAGGG - Intronic
1077497881 11:2895319-2895341 CAGGGTGCCTGGAGCAGGGAAGG + Intronic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1077602298 11:3582020-3582042 CTGTGGGGCTGGAGCATGGAGGG + Intergenic
1077603016 11:3586908-3586930 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1077900833 11:6487104-6487126 CAGTGTGGCCAGAGCACAGAGGG - Intronic
1079633303 11:22705201-22705223 CAGTGTGGCTGCAACAAAGTCGG - Intronic
1080149905 11:29039522-29039544 CAGTGTAGCTAAAGCACAGTGGG - Intergenic
1080708134 11:34718780-34718802 CAATGTGGCTGGAGCAGAACAGG + Intergenic
1081427251 11:42938846-42938868 CAATGTGGCTAGAGCAGAGTTGG - Intergenic
1081438940 11:43058857-43058879 AATTGTGCCTGGAGCACAGTGGG + Intergenic
1081765235 11:45605802-45605824 CAGTGTGCATGGAGCTCAGCAGG + Intergenic
1082275695 11:50219083-50219105 CACTGTGCCTGGCCCACAGAGGG - Intergenic
1082759262 11:57110943-57110965 CTGTGTGGCTGGAGAAGGGAAGG - Intergenic
1083213754 11:61205693-61205715 CAGTGTGGCGGGAACAGAGCCGG + Intronic
1083216639 11:61224522-61224544 CAGTGTGGCGGGAACAGAGCCGG + Intronic
1083219521 11:61243348-61243370 CAGTGTGGCGGGAACAGAGCCGG + Intronic
1084209635 11:67615046-67615068 GAGTGGGGCTGGAGCACAGGTGG - Intergenic
1084258896 11:67961446-67961468 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1084662866 11:70557462-70557484 CAGTGGGGGAGGAGCCCAGATGG + Intronic
1084706638 11:70819745-70819767 CAGCATGGCAGGAGCACAGAGGG - Intronic
1084813851 11:71633732-71633754 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1084814553 11:71638643-71638665 CTGTGGGGCTGGAGCATGGAGGG - Intergenic
1084864012 11:72041216-72041238 CAGTGGGGGTGGGGCCCAGAGGG + Intronic
1084994652 11:72964454-72964476 CAGTGTGGTAGTAGCACAAAGGG - Intronic
1085326503 11:75610664-75610686 CAGTGTGAATGGTGGACAGAAGG + Intronic
1085531486 11:77194683-77194705 CTGTGTGCCTGGCACACAGATGG - Intronic
1085726691 11:78960928-78960950 CACAGTGCCTGGAACACAGAAGG - Intronic
1086551660 11:88059644-88059666 CACTGTGCCTGGAACACAGTAGG - Intergenic
1086667719 11:89504236-89504258 TAGTGTTGCTGGAACACACAGGG + Intergenic
1086740065 11:90355799-90355821 CTGAGTGGCTGAATCACAGAAGG - Intergenic
1087188031 11:95222974-95222996 CACTGTGGTAGGAGTACAGATGG - Intronic
1087286587 11:96270923-96270945 CAGTGTGGCTAGAGTAAAGCAGG + Intronic
1087413475 11:97822571-97822593 CATTGAGGCTGTAGCACAGAGGG - Intergenic
1087825035 11:102755367-102755389 CAATGTGGCTGGAGCAGAGTGGG + Intergenic
1088318435 11:108530759-108530781 GAGGGTGCCTGGAGCACAGCTGG + Intronic
1088698732 11:112392642-112392664 CAGTGTGGCTGGATCCCATGAGG - Intergenic
1088851300 11:113705597-113705619 CAGTGAGGCTGCAGGACAGCAGG + Intronic
1089371040 11:117957838-117957860 CAGTGTGGCTGGAATAAAGCAGG - Intergenic
1089621736 11:119726599-119726621 CTGAGTGGGTGGAGCACAGCAGG + Intronic
1089676337 11:120092537-120092559 CAGTGTGGCTGGTGCAGAGAGGG + Intergenic
1089789400 11:120931895-120931917 CAGAGTGGCTAGAACACACAGGG - Intronic
1090350610 11:126105534-126105556 CAGTGTGCTTGGAGCAGAGCAGG - Intergenic
1090572491 11:128062643-128062665 CAGGGTGGCAGGAGCAAAGATGG + Intergenic
1091026022 11:132141974-132141996 CATTGAAGCTGGAGGACAGAAGG + Intronic
1091183102 11:133625265-133625287 CAGTGAGGAAGGAGCACTGATGG + Intergenic
1091671652 12:2456516-2456538 CAGTGTGGCTGGAGCAGGGCAGG - Intronic
1092209554 12:6637521-6637543 GAGTGTGGCTGGAGCCCAGGAGG + Intergenic
1092266379 12:6984011-6984033 GAGTGTTTCTGGAGCATAGATGG - Intronic
1092430222 12:8402454-8402476 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1092650781 12:10632439-10632461 CAGTGTAGCTGGAGCCAAGTGGG + Intronic
1092912762 12:13162555-13162577 CAATGAGGCTGGAGCTGAGAGGG - Intergenic
1093270656 12:17056750-17056772 CAGTGCTGCTATAGCACAGATGG - Intergenic
1093858188 12:24130975-24130997 TAGTGTAGCTGGAACTCAGAAGG - Intergenic
1094084385 12:26573761-26573783 CAGTGTGGATGGAGCAGAGTTGG + Intronic
1094389180 12:29930616-29930638 CAGGGAGGCTGCAGCACACAGGG - Intergenic
1094436841 12:30430269-30430291 CAGTGTGGCTGGTGCCCAGTGGG - Intergenic
1094472071 12:30812147-30812169 CAGTGTGGCTAGAACAAAGCAGG - Intergenic
1094554288 12:31482996-31483018 CATTGTTGCTGGAGCAGAGTGGG - Intronic
1095281812 12:40360760-40360782 CAGTTTGGGTAAAGCACAGATGG - Intronic
1095834771 12:46625560-46625582 GAGGATGGCTTGAGCACAGAAGG + Intergenic
1095966515 12:47870725-47870747 CAGTGGAGATGGAGCCCAGAGGG - Intronic
1096311394 12:50524451-50524473 CAATGTGGCTGAAGCACAATGGG - Intronic
1096409647 12:51367920-51367942 CAGGGTGGCAGAAGCACAAAGGG + Intronic
1096567964 12:52496830-52496852 CAGTGTGGAGGGAGGACAGGAGG + Intergenic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1096878394 12:54647993-54648015 CAGAGTGGTTGGAGCAGAGTGGG + Intronic
1097259688 12:57711121-57711143 CTGTGGGGCTGGAGCAGGGATGG - Intronic
1097285622 12:57874942-57874964 CAGTGTGGCTGGAGCAATGTAGG + Intergenic
1097951150 12:65429427-65429449 CAGTGTGGTTGAAGCACAAGGGG + Intronic
1098039678 12:66341330-66341352 CAGTGAGGCTAGAACACAGCAGG - Exonic
1098908862 12:76188950-76188972 CAGTGTAGCTGGAGAAAAGTAGG - Intergenic
1099088933 12:78280219-78280241 CAGTCTGCTTGGAGCCCAGAGGG - Intergenic
1099220840 12:79912023-79912045 CAGTGTGACTGGAGCACAGGGGG - Intronic
1099545179 12:83970373-83970395 CAAGGTGGCTGGGGCACAGCTGG + Intergenic
1099888564 12:88561743-88561765 CAGTGTGGCTAGAGCATGGTGGG - Intronic
1100904515 12:99282300-99282322 CAGTGTGGCTGGAGCAAAGTGGG + Intronic
1101147898 12:101858581-101858603 CAGTGTGACTGGAACACATGAGG - Intergenic
1102443236 12:112979400-112979422 AAGTGTGGCAGCAGCAGAGAAGG - Intronic
1102796639 12:115694792-115694814 AGGTGTGGCTGGAACACAGTAGG + Intergenic
1103542135 12:121673321-121673343 GTGTGTGGCTGGAGCAGAGACGG - Intergenic
1103567777 12:121825469-121825491 CAGAGGGGCTGGCACACAGAGGG + Intronic
1104261052 12:127182385-127182407 CAGTGTGGCTAGAATACAGCAGG - Intergenic
1104597897 12:130132482-130132504 TAGTGGGATTGGAGCACAGATGG + Intergenic
1104663314 12:130628054-130628076 CTGGGTGTCTGGAGCACAGATGG - Intronic
1104678090 12:130729367-130729389 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
1104725237 12:131071627-131071649 CAGTGCTGCTGGGCCACAGAGGG + Intronic
1105277937 13:18947113-18947135 CAGTGGGTGTGGAGCAGAGAGGG + Intergenic
1105403037 13:20112263-20112285 CAGCCTACCTGGAGCACAGATGG + Intergenic
1105523473 13:21152712-21152734 TGGTGTGGCTGGAGCACAAGGGG + Intergenic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1105784967 13:23739514-23739536 CAGTCAGGCAGGAGCCCAGAGGG + Intronic
1106139776 13:27002465-27002487 GAATGTGGCTGGAGCTCACAGGG - Intergenic
1106168456 13:27269562-27269584 AAGTGAGGCTGGAACACAGGAGG + Intergenic
1106862346 13:33923431-33923453 TAGTGTGGCTGGTGCATAGTTGG + Intronic
1108094826 13:46890662-46890684 CAGTGTGGCTGAGGAAAAGATGG + Intronic
1108243694 13:48493594-48493616 CGGTGTGGAGGGAGCACAGTGGG - Intronic
1108571355 13:51754978-51755000 GGGGATGGCTGGAGCACAGATGG - Intronic
1108621378 13:52187711-52187733 CAATTTGGCTGGAACACAGTGGG - Intergenic
1108665262 13:52623834-52623856 CAGTTTGGCTGGAACACAGCGGG + Intergenic
1108782835 13:53857650-53857672 CAGTGTGGCTAGAGCAGATTGGG + Intergenic
1110240298 13:73259274-73259296 CAGGGAGGCTGGAGAACAGCTGG - Intergenic
1110533672 13:76626706-76626728 CAGTGTGGCTAGAGTACAGAGGG - Intergenic
1111092802 13:83469310-83469332 TGATGTGGCTGAAGCACAGAAGG - Intergenic
1111947696 13:94682814-94682836 CAGTGTGGCTGGACCATTGTGGG + Intergenic
1112128925 13:96499739-96499761 CAGTGTGGCTGAAGCTGAGTGGG + Intronic
1113181931 13:107638841-107638863 TAGTGAGGCTGGAGAACAGTGGG + Intronic
1113218796 13:108074311-108074333 CAGTGTGGCTGGAACAAAGCAGG - Intergenic
1113460976 13:110481856-110481878 CAGTGTGTCTCCAGCACGGAGGG - Intronic
1113460980 13:110481885-110481907 CAGTGTGTCTCCAGCACGGAGGG - Intronic
1113460984 13:110481914-110481936 CAGTGTGTCTCCAGCACGGAGGG - Intronic
1113460988 13:110481943-110481965 CAGTGTGTCTCCAGCACGGAGGG - Intronic
1113745715 13:112742736-112742758 CAGTGTGGCTGGATCTCAGGGGG + Intronic
1113787761 13:113011605-113011627 CAGTGTGGATGGTGGACAGGTGG + Intronic
1113787857 13:113012096-113012118 CAGTGTGGATGGTGGACAGGTGG + Intronic
1113787873 13:113012177-113012199 CAGTGTGGATGGTGGACAGGCGG + Intronic
1113787895 13:113012300-113012322 CAGTGTGGATGGTGGACAGGTGG + Intronic
1113787968 13:113012689-113012711 CAGTGTGGATGGTGGACAGGTGG + Intronic
1114229456 14:20767482-20767504 CAAGGTGGTTGGAGCACAGCTGG - Intergenic
1114567984 14:23646393-23646415 CAGTGTGGTGGGAAAACAGAAGG + Intergenic
1116745277 14:48810166-48810188 CAGTGAGGCTAAAGCACAAAAGG + Intergenic
1117495452 14:56297658-56297680 CAGTGTGACTGGTGGACAGATGG + Exonic
1117753907 14:58954255-58954277 CAGTGTGGCTGGTGCACAGGTGG - Intergenic
1118026253 14:61772135-61772157 CACCGTGGCTGGAGCGCAGTAGG + Intronic
1118088912 14:62450584-62450606 TAGTGTGCTTGGAACACAGAAGG - Intergenic
1118252089 14:64171677-64171699 CAGTGTGACTGGCGCAGAGCTGG + Intronic
1118658932 14:67985818-67985840 CAGGATGGCTGGAGCTCAGGAGG + Intronic
1119004676 14:70912797-70912819 CAGTGTGACTACAGCACAGTGGG - Intronic
1119068077 14:71550970-71550992 CAGTGTGGCTGGAGAGGAAAGGG - Intronic
1119068163 14:71551748-71551770 CAGTGTGGCTGGAGGGGAAAGGG - Intronic
1119204343 14:72782999-72783021 CAGTGAGGATGGAGCCCAGCGGG - Intronic
1119477239 14:74937930-74937952 CAGTGTGGCTGGAGCATGATGGG - Intergenic
1119664015 14:76471514-76471536 CAGGGAGGCTGGAGCAGAGTGGG - Intronic
1119872418 14:78028935-78028957 AAGTATAGCTGGAGGACAGAAGG + Intergenic
1119949951 14:78734806-78734828 AAGTCAGGTTGGAGCACAGAAGG + Intronic
1120159641 14:81131550-81131572 CAGTGTTGCTGGTGCTGAGACGG - Intronic
1120515763 14:85468452-85468474 CAGAGTGACTGGAGCAAAGAAGG + Intergenic
1120823618 14:88935452-88935474 CAGAGTGGCTGGAGAGGAGAAGG - Intergenic
1120946763 14:90005150-90005172 GAGTGTGGCTGCAGAGCAGATGG - Intronic
1121011401 14:90522279-90522301 CGGTGTGCCTGGTGCACAGTGGG + Intergenic
1121729038 14:96173689-96173711 CTGTGTAGCTGCAGCTCAGAGGG + Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122117558 14:99535451-99535473 GAGTGTGGCTGGAGCTTGGAGGG - Intronic
1122250818 14:100438444-100438466 GAGAATGGCAGGAGCACAGAGGG - Intronic
1122297854 14:100715241-100715263 CTGCATGGCTGGGGCACAGAGGG + Intergenic
1122385391 14:101341828-101341850 CAGTGTGGCTGCAGCAAAGGAGG - Intergenic
1122724126 14:103739454-103739476 CAGTGTTGACGGAGCAGAGAGGG - Intronic
1123068293 14:105628952-105628974 GAGTGTGGCAGCAGGACAGAAGG - Intergenic
1124318274 15:28691857-28691879 CACTGAGGCTGGAGTACAGTGGG - Intergenic
1124353687 15:28979091-28979113 CACTGTGCCTGGAGCACTGCAGG + Intronic
1124565166 15:30805600-30805622 CACTGAGGCTGGAGTACAGTGGG + Intergenic
1124685898 15:31781698-31781720 TTGTGTGGCTCGAGCAGAGATGG - Intronic
1125310650 15:38374892-38374914 CAGTGTGGCCAGAGCTCTGAAGG - Intergenic
1125530067 15:40407265-40407287 GAATGCAGCTGGAGCACAGAGGG + Intronic
1125807710 15:42508402-42508424 TAGTGTGGCTGTCGCTCAGAGGG - Intronic
1127016650 15:54696165-54696187 CAGTTTGGCTGCAGCATAGTTGG - Intergenic
1127862821 15:63008653-63008675 CAGTGTGACAGGAGCTGAGATGG + Intergenic
1128102048 15:65010110-65010132 TGGTGTGGCTGGAGCATAGCTGG - Intronic
1128453219 15:67819242-67819264 CTGTCTGGTTGGAGCAAAGAAGG + Intergenic
1128460026 15:67859930-67859952 CAGAAGGGCTTGAGCACAGAGGG + Intergenic
1128506489 15:68276814-68276836 CAGTGTGGCTGCAGCAGAGTGGG - Intergenic
1128525004 15:68406356-68406378 CAGTATGGCTGGAGGAGAGGAGG - Intronic
1128831304 15:70771881-70771903 CAGTGTGGCTGGAGCATAGTGGG + Intergenic
1129503687 15:76063410-76063432 CAGTGTGGATGGAGCAGAATAGG - Intronic
1129931076 15:79411776-79411798 CAGCCTGGGTGGAGCCCAGAGGG + Intronic
1129993874 15:79988088-79988110 CAGTGTGTCTGGTGCAGATATGG - Intergenic
1130872007 15:87978950-87978972 AAGTGAGGCTGGAGCACGGCTGG + Intronic
1131167689 15:90154351-90154373 CAGTGTAGCTTGAGGGCAGATGG - Intergenic
1131371537 15:91885954-91885976 CAGTGTGTCTCTAGCAGAGAGGG + Intronic
1131543507 15:93296116-93296138 AAGGATGGCTGGAGCCCAGAAGG + Intergenic
1131822433 15:96286478-96286500 CAGTCAGGCTGGAACACAGAGGG + Intergenic
1132069094 15:98759823-98759845 CATTGTGGCTGAACCTCAGATGG - Intronic
1132345104 15:101103361-101103383 CAGTGTGGCTGTGGCACAGCTGG - Intergenic
1132670078 16:1098931-1098953 CTGTGGGGCTGGAGCAGACACGG + Intergenic
1132890738 16:2203378-2203400 CAGAGTGGCTGGGGCAAGGAAGG + Intergenic
1132929329 16:2450977-2450999 CAGTGGGGCTGGGGCAGACAGGG - Intronic
1132984410 16:2756793-2756815 CTGTGTGTCTGGGGCATAGATGG + Intronic
1133365965 16:5210419-5210441 CAGTCTGGCTGGAGGACAGTGGG - Intergenic
1133699025 16:8291786-8291808 AACAGTGGCTGGTGCACAGAAGG - Intergenic
1133747977 16:8701907-8701929 CAGTGTGGCTGGAGCAGAGCAGG + Intronic
1133772938 16:8878248-8878270 CAATGTGGCTGGAGTAGGGAGGG + Intergenic
1133905874 16:10021764-10021786 CAGTGGGGCTGGAGCAAATGAGG + Intronic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134362744 16:13546940-13546962 CAGTGTGGCTGTAGCACAGCAGG - Intergenic
1134414295 16:14030326-14030348 CAGTGTGGTTAGAGGGCAGAGGG - Intergenic
1134665229 16:16013881-16013903 GTGTGTGGCTGGAGCAGAGATGG + Intronic
1134887318 16:17805093-17805115 CAGCGTTGCTGTAGCACAGAAGG + Intergenic
1135763485 16:25156602-25156624 CAGTGTGGCTGGGGCTCGGGTGG + Intronic
1135780223 16:25293532-25293554 GAGTGTGGCTGAAGCAGAGATGG + Intergenic
1136012465 16:27372696-27372718 CACTGTGGCTGGGGGAGAGAAGG - Intergenic
1136092030 16:27927522-27927544 TTGTGTGGCTGGAGCACAGTGGG - Intronic
1136289707 16:29264245-29264267 GTGAGTGGCAGGAGCACAGAGGG - Intergenic
1136515012 16:30762722-30762744 CAGTTTGGCCAGAGAACAGAGGG - Intronic
1136940143 16:34515772-34515794 CAGTGTGGCTGGCCCAGATATGG - Intergenic
1136959675 16:34832794-34832816 CAGTGTGGCTGGCCCAGATATGG + Intergenic
1136967856 16:34937168-34937190 CAGTGTGGCTGGTCCAGATATGG + Intergenic
1137265563 16:46866407-46866429 GAGGATGGCTGGAGCTCAGAAGG + Intergenic
1137342696 16:47625468-47625490 CAGTGTGTCTGGAGCATAACAGG - Intronic
1137369964 16:47896012-47896034 CAGTCTGCCTGAAGCACAGAGGG + Intergenic
1137501507 16:49014985-49015007 CAGTGTGGCCGGAGCAGAGTGGG + Intergenic
1137537964 16:49341883-49341905 CTGTGTGGCTGGAGTTCAGTGGG + Intergenic
1137592275 16:49700856-49700878 CAGAGTGACTGGATCACACAGGG - Intronic
1137654620 16:50149567-50149589 GAGTATGGCTTGAGCACAGGAGG - Intergenic
1137682723 16:50364643-50364665 TAGAGTGGCTGGAACACAGGGGG + Intronic
1137706626 16:50539925-50539947 CACTGTGGCTGGCACACAGTAGG - Intergenic
1137934052 16:52616967-52616989 CAGTGGTGCTGGAGAACATATGG - Intergenic
1138001197 16:53281685-53281707 CACTGTGGCTGGAGCATGGTGGG - Intronic
1138197210 16:55060501-55060523 CCATGTGGCTGGAGCAGAGTGGG - Intergenic
1138373868 16:56549045-56549067 TACTGTGGCTGGCACACAGAAGG + Intergenic
1138677687 16:58663917-58663939 GAGTGTGGCTGGAGCGGAGAGGG + Intergenic
1138695554 16:58809614-58809636 CACTATGCCTGGAGAACAGATGG - Intergenic
1139412278 16:66773463-66773485 CAGTGTAGCTTGAGCTCAGAGGG - Intronic
1140237958 16:73175464-73175486 TAGTGTGGCTGGAACATAAAAGG - Intergenic
1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG + Intergenic
1140455945 16:75105607-75105629 CAGTGTGGCTGGTGCAGAGGAGG + Intronic
1140901579 16:79372810-79372832 CAGTGGGTCTGGAGCTGAGAGGG - Intergenic
1141057343 16:80830856-80830878 GAGTGTGGCTGCAGGACAGGAGG - Intergenic
1141173642 16:81705653-81705675 CAGTTTGGCTGAAGCAAGGAAGG - Intronic
1142095443 16:88237225-88237247 GTGCGTGGCAGGAGCACAGAGGG - Intergenic
1142529376 17:568656-568678 AGGTGTGGCTTGAGCACAGCTGG + Intronic
1142891606 17:2947637-2947659 CAGGCTGGCTGCAGAACAGAAGG - Intronic
1142951450 17:3484452-3484474 CAGTCTTGATGGATCACAGAAGG + Intronic
1143370718 17:6437301-6437323 CCGTGTGGCTGGAGAAAGGATGG - Intergenic
1143686172 17:8517823-8517845 CAGTGTGGCTGGAGCAGGATGGG - Intronic
1143947113 17:10603197-10603219 CAGTGTGGCAGGAACACAGTGGG + Intergenic
1143999071 17:11035750-11035772 CAGTGGGGCTGGAGCATGGAGGG - Intergenic
1144330842 17:14222802-14222824 CACTGTGGCTGGAGCAGTGTGGG - Intergenic
1144520388 17:15948768-15948790 CAATGTGGCAAGAGCAGAGAGGG - Intronic
1144537487 17:16105012-16105034 CAGTGTGGTTGGAGCAGAGGGGG + Intronic
1144539858 17:16130385-16130407 CAGGGTGGCTGGAGCAAAAGAGG + Intronic
1144699124 17:17325311-17325333 CTGAGTGTCTGGAGCTCAGAGGG - Intronic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1145769006 17:27479114-27479136 CAGGGAGACAGGAGCACAGAGGG - Intronic
1145838088 17:27969993-27970015 CAGTGAAGCTGGAGAAAAGAGGG - Intergenic
1146297657 17:31662205-31662227 CTGAGTGTCTGGAGCTCAGATGG + Intergenic
1146440149 17:32886925-32886947 CAGTGAGGGTGTAGCACAGAGGG - Intergenic
1146657746 17:34645028-34645050 GAGCAGGGCTGGAGCACAGAGGG + Intergenic
1147256845 17:39186652-39186674 CAGTGGGGCTGGAGCACCTCCGG - Intronic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1148497286 17:48060440-48060462 AGGGGTGGCTGGAGCACGGAGGG - Exonic
1148511628 17:48175856-48175878 CTGTGTGGCTGGGGCTCAGTGGG + Intronic
1148648383 17:49232053-49232075 CAGCCTGGCTGGTGCACAGTGGG + Intergenic
1148798276 17:50207963-50207985 CAGTGTGGCTGGAGCACCACAGG + Intergenic
1148800403 17:50221354-50221376 CACAGTGCCTGGCGCACAGAAGG + Intergenic
1148837250 17:50471846-50471868 CAGTGCAGCTGTAGCACACACGG - Intronic
1149004534 17:51791415-51791437 CAGAGTGCCTGGTGCACAGTGGG + Intronic
1150292511 17:63989592-63989614 CAGTGAGGCTGGAGCCCAAGTGG - Intergenic
1150365597 17:64581336-64581358 GAGTGTGGCTGAAGCAGAGTGGG - Intronic
1150865278 17:68842633-68842655 TTGTGAAGCTGGAGCACAGATGG - Intergenic
1151295120 17:73179626-73179648 CAGGGTGGATGGAGCAGAGCCGG + Intergenic
1151434049 17:74083172-74083194 AAGTGTGGCAGCAGCCCAGATGG + Intergenic
1151589157 17:75032183-75032205 CAATTTGGCTGGAACCCAGAGGG + Intergenic
1151874161 17:76857067-76857089 CATGGAGGCTGGAGCAGAGATGG + Intergenic
1151921006 17:77155485-77155507 CAGTCTTGCTGGTGCCCAGATGG + Intronic
1152036405 17:77875776-77875798 AAGTGTGGCAGGAACACAGAGGG + Intergenic
1152261248 17:79268512-79268534 AACTGTGGCTGGAGCTCAGAGGG - Intronic
1152559516 17:81070919-81070941 CAGTGGGGGTGGATGACAGAAGG + Intronic
1153827904 18:8893662-8893684 CTGTGTGGCTGGAGGAGAGGAGG + Intergenic
1154115407 18:11609527-11609549 CACAGTGGCTGGAGCTCTGAGGG + Intergenic
1157005142 18:43574003-43574025 CAGTGAGGCTGAAACACTGAGGG - Intergenic
1157158236 18:45288394-45288416 CAGTGGGGCAGGAGCAACGATGG + Intronic
1157258158 18:46156678-46156700 CAGTGAGGATGGAGAACAGAGGG + Intergenic
1157674123 18:49555853-49555875 CAGTGTGGCAGGAAGGCAGAGGG + Intergenic
1157845465 18:51000125-51000147 CAGAGTGGCTGGAACAAAGCTGG + Intronic
1158117824 18:54016312-54016334 CAATGTGGCTGGAGTTCACAGGG - Intergenic
1158131420 18:54157042-54157064 CACCGTCTCTGGAGCACAGAGGG - Intronic
1158943208 18:62425336-62425358 CAGTGTGGCCCGAACACAGATGG - Intergenic
1159340221 18:67124958-67124980 CAGTGTTCCTGGAGCTCAGCCGG - Intergenic
1159904365 18:74076827-74076849 CAGTGTGGCTGGAGCACAGATGG - Intronic
1159997551 18:74980887-74980909 CAGTGTGTCTGGGGCTGAGAAGG - Intronic
1160399081 18:78596068-78596090 CAGTGTGGGTGGAGCCCTGCTGG + Intergenic
1160916835 19:1500799-1500821 TCCTGTGGCTGGAGCAGAGAAGG + Intergenic
1161205550 19:3039384-3039406 CTGTGTGGCTGGAACAGAGGGGG - Intronic
1161348069 19:3777820-3777842 CACTGGGGCTGGGGCACACAGGG + Intergenic
1161540037 19:4844988-4845010 CTGTGTGGTTGGTGCAAAGAAGG + Intronic
1161606811 19:5219645-5219667 GAGAGTGGCTGGAGCAGAGAAGG - Intronic
1161615264 19:5266705-5266727 GAGGGTGGCCGGACCACAGAAGG - Intronic
1161636620 19:5393318-5393340 CCGTGCAGCTGGAGCAGAGAGGG - Intergenic
1161638813 19:5406803-5406825 CAGTGTGGCTGGAGCAGAATGGG - Intergenic
1162087845 19:8259362-8259384 CTGTGTGGCTGGAGCAGAGTGGG + Intronic
1162487634 19:10971232-10971254 CAGTGTGGCTGGAGCAGGGAAGG - Intronic
1162550965 19:11357913-11357935 CAGTGTGGATGGGGCAGAGAGGG - Intronic
1163429919 19:17261216-17261238 CAGTGTGGCTGGAACACAGGGGG - Intronic
1163597790 19:18230552-18230574 CAGTGTGGCTTGAGGATGGAAGG - Intronic
1164695640 19:30241594-30241616 CAGTGTGGCTGGAGTAAAAAAGG + Intronic
1165008827 19:32828371-32828393 CATTGTGGCTGCAGCACTGGGGG + Intronic
1165054065 19:33162552-33162574 CACTGTGGCTTAAGCAGAGAAGG - Intronic
1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG + Intergenic
1165387220 19:35517630-35517652 CATTGTGGCTGGAGCAGTGTTGG + Intergenic
1165462349 19:35951577-35951599 CAGTGTGGCTGGCGCACCATGGG + Intergenic
1165830957 19:38729919-38729941 AAGTGAGTCTGGAGCAGAGAGGG - Exonic
1165891235 19:39113502-39113524 CAGTGTGGCTGCAGCAGAGTGGG - Intergenic
1165995338 19:39839941-39839963 CAGGGTGGCTGGAGGACACTTGG + Intronic
1166053291 19:40273931-40273953 CAGTGAGGCTGGAGAGCAGGCGG - Intronic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166219612 19:41355995-41356017 CAGTATGGCTGGAGCCCAGACGG + Intronic
1166268138 19:41697353-41697375 CAGAGTGGCTGGAGCAGAGAGGG - Intronic
1166321936 19:42024008-42024030 CATCATGGCTGGAGCACAGCTGG - Intronic
1166552079 19:43672505-43672527 CAGTGTGGCTGGAACAGATTAGG + Intergenic
1166713521 19:44951957-44951979 CAGAGTAGCTGGACCACAGGTGG + Intronic
1166729375 19:45050121-45050143 CTGTGTGCCTGGAGCAGAGTAGG + Intronic
1167251638 19:48401580-48401602 GAGTGTGGCTGGAGCCCACTGGG + Intronic
1167487708 19:49772862-49772884 CTGTGTGGCTGGTGCAGAGAGGG + Intronic
1167708578 19:51096859-51096881 CAGTGTGGCGGGAACAGAGTGGG - Intergenic
1167882119 19:52468729-52468751 CAGTGTGGCTAGAACAAAGCAGG + Intronic
1167958505 19:53087207-53087229 CTGTGTGACTGGAGCAGAGGGGG + Intronic
925572491 2:5326528-5326550 CAGTGTGGCTGGGACAAAGCCGG - Intergenic
925865266 2:8221428-8221450 CAGTGTGGGCTGTGCACAGAGGG - Intergenic
925900764 2:8508081-8508103 CACTGTGCCTGGGACACAGAAGG - Intergenic
926709602 2:15867923-15867945 CAGAGTGGACGGAGCACACAAGG + Intergenic
926867635 2:17376923-17376945 CAGTGAGGTTGCAACACAGAGGG + Intergenic
927128523 2:20036233-20036255 CATGGTGGCTGGCACACAGAGGG - Intronic
927519934 2:23692595-23692617 CAGTGAGGCTCGCGCACAGATGG + Intronic
927560567 2:24069524-24069546 CTGGGTGGTTGGAACACAGATGG - Intronic
930226333 2:48797942-48797964 CAGTGTGGCTGGAACTTCGAAGG + Intergenic
930511411 2:52349913-52349935 CAGTGTGGCTGCAACAGAGTGGG - Intergenic
930889035 2:56361666-56361688 CAATGTGGCTGGAACAGAGTGGG + Intronic
931894830 2:66717117-66717139 CACTGCTTCTGGAGCACAGAAGG - Intergenic
932076849 2:68672301-68672323 TAGTGTGGCTGGAGTAAGGAGGG + Intergenic
932263182 2:70344045-70344067 CAGAGTGGCTGCAGCTGAGATGG + Intergenic
932561491 2:72875178-72875200 CAGTGTGGCTGGAATAAAGCAGG - Intergenic
933149677 2:78899211-78899233 CAGTGTGGCTGGGAGAGAGAGGG + Intergenic
933699454 2:85244148-85244170 CAGAGTGGCTGGAGCAGAGTGGG + Intronic
933804516 2:85988501-85988523 TGGTCTGGCTGGAGCACAGGTGG - Intergenic
933860179 2:86458723-86458745 CATTGTGGCAGGGGCACAGGAGG + Intronic
934576452 2:95404717-95404739 CACTGTGCCTGGTGCACAGAAGG - Intronic
934638677 2:96012883-96012905 CACTGTGCCTGGTGTACAGAAGG - Intergenic
934729540 2:96647913-96647935 CAGGGTGGCTGGAGGAATGAGGG + Intergenic
934794971 2:97092519-97092541 CACTGTGCCTGGTGCACAGAAGG + Intronic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
936573843 2:113637363-113637385 CAGTGGTGCAGGAGCACACACGG - Intronic
936845219 2:116822624-116822646 TACTGTGGCTGGGACACAGATGG - Intergenic
937230934 2:120397744-120397766 CAGTGGGGCTGCAACACACAAGG + Intergenic
937348548 2:121143707-121143729 CAGTGAGGCTGGAGCAGAGAGGG + Intergenic
937996467 2:127698271-127698293 CACTGTGAATGGAGCCCAGAAGG + Intergenic
938515411 2:132000696-132000718 CACTCTGGCTGGAGCACATACGG - Intergenic
938902709 2:135811563-135811585 CAGTGTGGCTGGAGCAATGAGGG + Intronic
939177569 2:138767252-138767274 CAGTGTGGCCTGACCACAGAAGG + Intronic
940211402 2:151259547-151259569 CAGAATGGCTGGAACACAGGAGG + Intronic
940259565 2:151765944-151765966 GAGTGTGGCCTGAGCACGGAGGG - Intergenic
940711424 2:157167049-157167071 CAGTGTGGCTAGAACAAAGCAGG + Intergenic
940841527 2:158587988-158588010 CAATGTGGCTGGATCTCAAATGG - Intronic
941052118 2:160746840-160746862 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
941201674 2:162518869-162518891 CAGAGTGGCTGATGCACAGAAGG + Intronic
941379579 2:164776342-164776364 CAGTGTTGCTGGAACAAAGTGGG - Intronic
941422528 2:165300671-165300693 CTGAGTGGCTGGAGCAGAGTGGG + Intronic
941631017 2:167884280-167884302 CAGTATGGCCAGAGCACAGAGGG - Intergenic
942188121 2:173444108-173444130 AAGAGTGGGTGGAGCAGAGATGG - Intergenic
942212625 2:173686653-173686675 CAGTGTGATTGGAGGACAAAGGG - Intergenic
942618626 2:177823194-177823216 CAATGTGTCTGGTGCATAGAAGG - Intronic
943731776 2:191309619-191309641 CAGCGTGGCTGGGGAAGAGAGGG - Intronic
944136636 2:196406680-196406702 CAGAGTGGCTGGAGCATGGCGGG - Intronic
945420834 2:209634048-209634070 CGGTGTGGCTGGAGCAAAGATGG - Intronic
946157837 2:217818500-217818522 CAGTGTGGCTGGCGTCCACACGG - Exonic
946187654 2:217990234-217990256 GAGTGTGGCTGGTGTATAGATGG - Intronic
946449146 2:219764686-219764708 CACTGTGGCTGCAGCACATCAGG + Intergenic
946459521 2:219856684-219856706 CAGTGTAACTGGAGCATAGGGGG + Intergenic
947078911 2:226373849-226373871 CACTGTGGTTGGAGCACAGCAGG - Intergenic
947275101 2:228381894-228381916 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
947468572 2:230378359-230378381 CATTGTGGCTGGAGCTTAGCAGG - Intronic
947526416 2:230879258-230879280 GAGTGTGGCTGGAGGGGAGATGG + Intergenic
948018491 2:234710060-234710082 CGAGGTGGCAGGAGCACAGAAGG - Intergenic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
948513346 2:238487835-238487857 CACTGTGGCTGGCGCTCAGGAGG - Intergenic
948554261 2:238796409-238796431 CTGTGTGGCAGGAGGACAGCTGG + Intergenic
1168788079 20:557017-557039 CATTGAGGCTAGAGCACAGTGGG - Intergenic
1168930754 20:1621576-1621598 CAATGTGGCAGATGCACAGAGGG + Intergenic
1168962796 20:1880463-1880485 CAGTGTGGCTGAAGCAGAGTGGG + Intergenic
1169088835 20:2844836-2844858 CAGTGTGGCTGGAGTGCTGTAGG + Intronic
1169162814 20:3396712-3396734 CGGTATGGCTGGAGCAGAGTAGG + Intronic
1169275336 20:4229970-4229992 CAATGTGGCTGGAACAGAGTAGG - Intronic
1170199407 20:13726344-13726366 CAGTGTGGCTGGAGCATTGTCGG - Intronic
1170469595 20:16655338-16655360 GAGTGTCACTGAAGCACAGATGG + Intergenic
1170574628 20:17653061-17653083 AAGTGTGCCCGGAGCAGAGAAGG + Intronic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1170693742 20:18638583-18638605 CAGTGTGGCTGGAGCTTGGAGGG + Intronic
1170994278 20:21336991-21337013 CAGTGTGGAAGGAGCAGAGGAGG + Intronic
1171324224 20:24276633-24276655 CAGTGTGGGTGCAGGACAGCAGG + Intergenic
1171981374 20:31631683-31631705 CAGTGTGGCTGGGGCATGGTGGG + Intergenic
1172037680 20:32021229-32021251 CATGGTGGCTGGAGTACAAATGG - Intronic
1172041045 20:32046156-32046178 CATTGTGGCTGGAACACAGAGGG - Intergenic
1172282268 20:33716313-33716335 CAGTGTGGCTGGAGCAGCAGAGG - Intronic
1172638700 20:36427708-36427730 CAAGGTGGGTGGATCACAGAAGG + Intronic
1172669798 20:36627145-36627167 CAGAGTGGCTGGTGGGCAGAGGG + Intronic
1172758148 20:37301958-37301980 GACTGTGGCCAGAGCACAGAGGG + Intronic
1172763928 20:37340872-37340894 CTGTGTGGCCGGTTCACAGATGG - Intergenic
1172874419 20:38155700-38155722 TTGTGAGGCTGGAGCACAGTGGG + Intronic
1172972363 20:38882943-38882965 CAGTGTGGCTGAACCAGTGAGGG + Intronic
1173225069 20:41157774-41157796 TAGTGTGGATGGAGCAGAGAGGG + Intronic
1173343369 20:42175302-42175324 CAGTGTGGCTGCAGCCTAGAGGG - Intronic
1173747088 20:45445971-45445993 CAGTGTGGCTGGGGCTGAGTGGG + Intergenic
1173926536 20:46785238-46785260 CAGTGGGGTTGCAGCAAAGAGGG - Intergenic
1174066324 20:47868262-47868284 AACTGTGCCTGGAGCACAGTCGG + Intergenic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1174308524 20:49632236-49632258 CAGCGTGGCTGGAGTAGAGGGGG - Intergenic
1174398886 20:50265105-50265127 CTGTGTGGCTGCAGCCCACAGGG - Intergenic
1174727249 20:52876078-52876100 CAGTGTGGTTGGAGTAGGGATGG + Intergenic
1175123591 20:56735583-56735605 CAGTGTGGCTCCAGCTCCGAGGG + Intergenic
1175278680 20:57788368-57788390 CAGCGTGGCTGGAGGGCAGCAGG - Intergenic
1175665432 20:60854604-60854626 CAGTGCGGCTGGAACAAAGCAGG - Intergenic
1175833394 20:61979175-61979197 CCGTGTGGGTTGGGCACAGAAGG - Intronic
1175985810 20:62763725-62763747 CAGAGTGGCTGGAGAGGAGAAGG + Intergenic
1176028078 20:62996316-62996338 CAGTGTGTCTGGACCACAGCAGG + Intergenic
1176148745 20:63577983-63578005 CACTGTGGCCTGAGCACAGCTGG - Intergenic
1176295793 21:5071743-5071765 CAGTGTCCTTGGTGCACAGATGG - Intergenic
1176419988 21:6506351-6506373 CAGTGTGGCTGGAACAAAGCAGG + Intergenic
1176960776 21:15156452-15156474 CAGTGTGTCTGGGGCTCACAAGG - Intergenic
1176963747 21:15188787-15188809 CAGTGAGGCTGGAACACCCAAGG - Intergenic
1177285418 21:19042375-19042397 CAATGTGGTTGGAACACTGATGG - Intergenic
1177976006 21:27851248-27851270 CACTCTGGCTGGAGCACATACGG + Intergenic
1178798449 21:35767748-35767770 CAGTGTGGCTACAGGAGAGAAGG - Intronic
1179570658 21:42276853-42276875 CAGTGTGGAAGCAGAACAGACGG - Intronic
1179695479 21:43114671-43114693 CAGTGTGGCTGGAACAAAGCAGG + Intergenic
1179861254 21:44190381-44190403 CAGTGTCCTTGGTGCACAGATGG + Intergenic
1180701909 22:17785764-17785786 CAGTGTGGCTGTGGCACATGTGG + Intergenic
1180703060 22:17792110-17792132 CACTGTGGCAGGAGGACAGAAGG + Intronic
1180897919 22:19350767-19350789 CACTGTGGCTGGCACATAGAAGG - Intronic
1181544256 22:23592102-23592124 CAATGGGGCTGGAGCATGGAGGG + Intergenic
1181842654 22:25677248-25677270 CAGAGTAGCTGGAGCATAGCTGG - Intronic
1181902615 22:26169033-26169055 CAGGCTGGCTGGATCCCAGAGGG + Intergenic
1181967350 22:26666508-26666530 CAGTGTGGCAGGAGCAGAGCTGG + Intergenic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
1182320755 22:29477452-29477474 AAGTTTGGCTGGAAAACAGACGG + Intergenic
1182953934 22:34403191-34403213 CAGTATGGCTAGAGCATAGCGGG - Intergenic
1182985046 22:34708283-34708305 CAGTGGGAGAGGAGCACAGAAGG - Intergenic
1183097334 22:35560932-35560954 CAATGTAGCTGGAGCACAGAGGG + Intergenic
1183443104 22:37834606-37834628 CAGGGCGGCTTGAGCCCAGAAGG + Intronic
1183740795 22:39667387-39667409 CACAGTGGCAGGAGCGCAGAGGG + Intronic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184160898 22:42696799-42696821 AGGTGTGGCTGGGGCACAGGTGG - Intronic
1184263425 22:43332851-43332873 TAGTGTGACAGGAGCACTGAGGG + Intronic
1184329688 22:43819452-43819474 CAGTGTGGCTGGGCCAGAGAGGG + Intergenic
1184355755 22:43978528-43978550 AGGGGTGGCTGGAGGACAGAGGG + Intronic
1184374754 22:44104710-44104732 CAGGGTGGCTGGGGCAGTGAAGG - Intronic
1184781949 22:46654097-46654119 CGGTGTGGCTGGCATACAGAAGG - Intronic
1184783088 22:46658775-46658797 CAGCGTGGCTGGGGCAGACAGGG - Intronic
1184841985 22:47057403-47057425 CAGGGTGGCTCGAACCCAGATGG + Intronic
949660706 3:6275315-6275337 CAGTGTGACTGGAACAAAGCAGG - Intergenic
949669361 3:6380676-6380698 CAGGCTGGCTGGAGCAGAAATGG + Intergenic
950076474 3:10190912-10190934 CACTGTGGCTGGGGAAGAGAGGG + Intronic
950183704 3:10932426-10932448 GAGTGGGGCTGGTGCACAGTAGG - Intronic
950478432 3:13228707-13228729 CAGCAAGGTTGGAGCACAGAGGG - Intergenic
950552399 3:13674779-13674801 CAGCGTGGCTGAAACACAGTAGG + Intergenic
950681533 3:14588534-14588556 CAGTGAGGCTGGACCCCAGAAGG - Intergenic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
951931225 3:27969178-27969200 CTGTGTGGTTGGAGCAGAGAGGG - Intergenic
952331233 3:32366176-32366198 CAGTGTGGGGGGCGCACAGAGGG + Intronic
952635545 3:35524974-35524996 CAGAGTGACTATAGCACAGAGGG - Intergenic
953000905 3:38932227-38932249 CAGTCAGGCTGGAGCCAAGATGG + Intronic
953335331 3:42089524-42089546 CAGTGTACCTGGAGCACGGAGGG - Intronic
953399761 3:42602465-42602487 CAGTGTGGCTGGAGTAGAAGAGG + Intronic
953447622 3:42981018-42981040 CAGAGTGCCTGGAGGAGAGATGG + Intronic
953576973 3:44120734-44120756 CAGTGGGGCTGGGGCAGAGTGGG - Intergenic
954445010 3:50541837-50541859 CCCTGTGGCTGGAACCCAGAGGG + Intergenic
954631689 3:52051187-52051209 AGGTGGGGCTGGGGCACAGAGGG + Intronic
954660440 3:52224194-52224216 CCGTGGGGCTGGAGCTCACAGGG + Exonic
955214121 3:56970985-56971007 CTTAGTGACTGGAGCACAGAAGG + Intronic
955503825 3:59611381-59611403 CAGTGTGGCTGGAACACAGTGGG + Intergenic
955807967 3:62756815-62756837 CAGTGTGGCTGTGGCAATGAGGG + Intronic
955829596 3:62986932-62986954 CAGTGGGGCTGGGGCAGAGTGGG - Intergenic
955961579 3:64346317-64346339 CGGTGTGGCTGGAGCACAGTGGG + Intronic
956519172 3:70084768-70084790 TAGTGTGCCTGGAACACAGTAGG - Intergenic
956682096 3:71790439-71790461 CAGTGTGGCAGGAGCAGAGCTGG - Intergenic
956918320 3:73898508-73898530 CAGTGTGACTGTATCATAGAAGG - Intergenic
956960489 3:74393667-74393689 CAGTATGGCTGAAACACAGAGGG + Intronic
957121289 3:76097204-76097226 CTCTGTGGCTGCAGCACATAGGG - Intronic
957151888 3:76497066-76497088 CATTGTGGCTGGAGTGCAGTGGG - Intronic
957162954 3:76634218-76634240 CAGGGATGCAGGAGCACAGAAGG - Intronic
957774006 3:84732049-84732071 CAATGTGACTGGATCATAGAGGG + Intergenic
957842957 3:85694676-85694698 GAGTGTGTCTGGAGTATAGATGG - Intronic
957948893 3:87098373-87098395 CAGTGAGGGTGGAGCCAAGATGG - Intergenic
958833251 3:99114963-99114985 CAGAGGGGCTGGAGCTAAGATGG + Intergenic
959403875 3:105936842-105936864 ATGAGTGACTGGAGCACAGAGGG - Intergenic
959701932 3:109307056-109307078 GAGAGTGGCTTGAGCCCAGAAGG - Intronic
959824066 3:110771832-110771854 CAGTGTGGCTGCAGCAGAGCTGG - Intergenic
960399780 3:117182127-117182149 CAGTAAGCCTGGTGCACAGAAGG - Intergenic
960430546 3:117563310-117563332 CAGTCTGGCTGGAGTGCAGTAGG + Intergenic
961262683 3:125615312-125615334 CAGTGTGGCTAGAACAAAGCAGG + Intergenic
961280237 3:125760754-125760776 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
961332291 3:126149714-126149736 CACTGTAGCTGGAGCCCAGGGGG - Intronic
961655345 3:128438734-128438756 CCGTGTGCCTGGAGCACTGCAGG + Intergenic
961786271 3:129348943-129348965 CAGCAAGGCTGGAGCACAGAGGG + Intergenic
961874169 3:130008793-130008815 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
962350048 3:134650070-134650092 CAATGTGAATGGAGTACAGAGGG - Intronic
962436943 3:135375454-135375476 CAGTGTGGCTGAAATCCAGATGG - Intergenic
962449493 3:135500792-135500814 CAGTGTGGCTAGAGTACAGCAGG + Intergenic
962623680 3:137203582-137203604 CACTGTGCCTGGAACACAGTAGG + Intergenic
963460235 3:145603323-145603345 CAGTATGGCTGGATCTCAGATGG - Intergenic
964142556 3:153420243-153420265 CAGTCTGTGTGGAGCCCAGAAGG - Intergenic
964415885 3:156446982-156447004 CAGTGTGGCCAGAGAAGAGAAGG - Intronic
964612829 3:158632099-158632121 CAATGTGGCTGGAGCAAAAGGGG + Intergenic
965392671 3:168123993-168124015 GAGTGTGGCTGTATCTCAGAGGG - Intergenic
965610559 3:170539168-170539190 CAGTGTGGCTGAACCAAGGAGGG - Intronic
965745370 3:171919319-171919341 CAGGGAGGCTGGAACACACAGGG + Intronic
965792186 3:172401536-172401558 CAGTGTGCCAGGTGAACAGAGGG - Exonic
966116378 3:176468265-176468287 CAATGTGGCTAGAACAAAGAAGG + Intergenic
966891429 3:184410147-184410169 CACTGTGGCTGGAGTGCAGTGGG - Intronic
967120055 3:186374709-186374731 CATTCTGGCTGCAGGACAGAAGG - Intergenic
967815663 3:193796168-193796190 CAGCGTGGCTGGAGTAAAGAGGG - Intergenic
967948971 3:194825618-194825640 CAGTGTTGAGGGAGGACAGATGG - Intergenic
968770304 4:2501413-2501435 CAGGGAGGCTGGAGCCCAGGAGG + Intronic
968910689 4:3475736-3475758 CTGTGTGGCTCCATCACAGAAGG - Intronic
969736512 4:8995029-8995051 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
969737218 4:8999934-8999956 CTGTGGGGCTGGAGCATGGAGGG - Intergenic
969890615 4:10256607-10256629 CAGTGTCAATGGAGCACACATGG - Intergenic
969982566 4:11173225-11173247 CAGTGTGGCTGGAATAAAGCAGG + Intergenic
970159103 4:13171332-13171354 CAGTGTGGCTGGTGCAGAGAGGG - Intergenic
970169891 4:13278946-13278968 CAGTGGGGCAGGAGCACTGGAGG - Intergenic
970380142 4:15499118-15499140 CTGAATGGGTGGAGCACAGAAGG + Intronic
970703483 4:18771115-18771137 CAGTCTGTGTGGAGCCCAGAAGG + Intergenic
971271505 4:25151339-25151361 AAGGGTGGTTGGAGCACAGCAGG + Intronic
972631306 4:40844240-40844262 CAGTGTGCCTGGCACACAGAGGG - Intronic
973168075 4:47102669-47102691 CAATGTGGCTGGAACATAAAGGG + Intronic
973550094 4:52025502-52025524 CAGTGTGGAAGAAGCACGGAGGG + Intronic
973553482 4:52058505-52058527 CAATGTGGCAGAGGCACAGAAGG - Intronic
973607212 4:52599837-52599859 CAGATGGGCTGGAGCTCAGAGGG - Intronic
973666600 4:53165571-53165593 CAGTGTGGCTGGAGCAAACAAGG - Intronic
973668609 4:53190350-53190372 CCATGTGGCTGGAGCACAGCAGG - Intronic
973811321 4:54573139-54573161 GAGTATGGCTGGAGCACAGGTGG - Intergenic
975428613 4:74260054-74260076 CAGTCTGCCTAGAGCCCAGAGGG - Intronic
976035877 4:80820514-80820536 CAGTGTTGCTGGAGCGTAGTGGG + Intronic
976500680 4:85785182-85785204 CACTGTGGCTGGCACATAGAAGG - Intronic
976528242 4:86118381-86118403 CAGTGTGGCTGGAGAATTGTTGG - Intronic
976763613 4:88576417-88576439 CAGCATGGCTGGAGCAGAGTGGG - Intronic
977679642 4:99784960-99784982 TAGTGTGGCTGGAGCAGAGCAGG - Intergenic
978217726 4:106226072-106226094 AAGGGTGGCTTGAGCACAGGAGG + Intronic
978871925 4:113589111-113589133 CAGTGTGGCTGGGGCTGAGTGGG + Intronic
979745493 4:124207340-124207362 CAGTGAGGCTGAATCCCAGAGGG - Intergenic
981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
981423242 4:144575365-144575387 AAGTGAGGCTGGAGCCCAGGAGG + Intergenic
982469796 4:155774248-155774270 CAATGTGGCTGGAACAGAGGAGG - Intronic
984678349 4:182577011-182577033 CAGACTGGCTAGAACACAGAGGG - Intronic
984747639 4:183238550-183238572 CACTGTGGCTGGATTACAGAGGG - Intronic
984853155 4:184171098-184171120 CAGTCTGGATGGAGCATGGAAGG + Intronic
985500567 5:241849-241871 CAGTGTGACTAAGGCACAGAAGG + Intronic
985709374 5:1419763-1419785 AAGTGTGCCTGCAGCACTGAAGG - Intronic
985901333 5:2797299-2797321 GAGTGTGGCAGGTGCACAGCCGG + Intergenic
985937605 5:3108719-3108741 CAGTGTGGGTAGGGCAGAGACGG - Intergenic
986134232 5:4959322-4959344 AAGGGTGGCTGGAGCAGGGAAGG - Intergenic
986926071 5:12753645-12753667 CAGTGCGGCTGGAACAAAGCAGG - Intergenic
987269378 5:16290386-16290408 CATTGTGGCAGGAGCAGAGGGGG + Intergenic
990399455 5:55423464-55423486 CAGTGTGGCTGGAGCAGAATGGG + Intronic
991446198 5:66702677-66702699 GAGTGTGGCTGGAGCAGAACAGG + Intronic
991682745 5:69154752-69154774 CAGTGTGGCTAGAGTATAGAGGG - Intergenic
992783158 5:80146229-80146251 CAGTGTCTGTGAAGCACAGAGGG + Exonic
993042730 5:82834072-82834094 CAGGGTGGAAGGAGCAGAGAGGG + Intergenic
993740157 5:91528941-91528963 CAGTGTTACTGGAGCACAAGTGG - Intergenic
994193735 5:96898810-96898832 AAGTGTGTCTGGACCACTGACGG - Intronic
996036051 5:118759914-118759936 CAGTGTGGCTAGAGTAAAGCAGG - Intergenic
996273465 5:121636853-121636875 CAGTGTGGCTAGAACACAGTAGG - Intergenic
996626812 5:125580071-125580093 GAGGGTGGCTTGAGCACAGGAGG - Intergenic
997360504 5:133291777-133291799 GGGTGTGGACGGAGCACAGAGGG + Intronic
997643372 5:135464305-135464327 CAGCATGGCTGGAGCACGGGAGG - Intergenic
997894297 5:137702461-137702483 CAGTCTGGCTGGAGCACATTAGG + Intronic
998112410 5:139512417-139512439 CAGTCTTGCGGGAGCACACAAGG - Intergenic
998224850 5:140319033-140319055 CAGCGTGGCTGGGGCCTAGAGGG - Intergenic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
999054320 5:148557484-148557506 ATGTGTGTCTGGAGCTCAGAGGG + Intronic
999138203 5:149337966-149337988 CAGAGCAGCTGGAGCAAAGAGGG + Intronic
999175590 5:149629599-149629621 CAGTGTGGCCGGAGAAGAAAGGG + Intronic
999538883 5:152549977-152549999 CAGTGTGGCTGGAGTAAAATGGG - Intergenic
1000166759 5:158657314-158657336 CAGGGTGGCTGGACCACAGATGG - Intergenic
1000326662 5:160177527-160177549 CAGTGTGGCTGGATCAGAGGAGG - Intergenic
1000398234 5:160798217-160798239 CACTGTGGCTAGAGCTCAGCTGG + Intronic
1000922978 5:167160372-167160394 CAGTGAGGCTGGAGCACAGCAGG - Intergenic
1001479979 5:172081920-172081942 CAGAGAGGGTGGAGCATAGAGGG + Intronic
1001929672 5:175664022-175664044 AAGTGTGGCTGGAGCCAAGTTGG + Intronic
1001929899 5:175665425-175665447 CTGGATGCCTGGAGCACAGAGGG + Intronic
1001966515 5:175913672-175913694 CAGTGTGGCTGCAGCAAGTAGGG + Intergenic
1002621584 5:180492313-180492335 CACCCAGGCTGGAGCACAGACGG + Intergenic
1002872526 6:1179669-1179691 CAGTGTGGCTGGAGCAGGGGAGG - Intergenic
1003208322 6:4035590-4035612 CATTTTGGCTGGATCAGAGAAGG + Intronic
1003257256 6:4485308-4485330 CACTGTGGCTGGGGCAGAGTGGG - Intergenic
1003530154 6:6930360-6930382 CAGTCTGGCTGGGGCAGAGTAGG + Intergenic
1003722078 6:8715032-8715054 CAGTGCAGATGGAGAACAGAAGG - Intergenic
1003890635 6:10560914-10560936 CTGTGTGGCTTGTGCACAGATGG + Intronic
1003942071 6:11039308-11039330 CTGTGTGCCTGGTGAACAGAGGG - Intronic
1004031979 6:11879587-11879609 CAGGGTGGCTGTCTCACAGAGGG + Intergenic
1004698768 6:18058942-18058964 CAGTGTGGGTGCAGGACAGTGGG + Intergenic
1004817633 6:19329880-19329902 CAGTGTGGCTGAAGTAGAGTGGG + Intergenic
1004999417 6:21225528-21225550 CAGAGTGCCTGGAATACAGAAGG - Intronic
1005355473 6:24979191-24979213 CAGTGGGAGTGGAGCAGAGAGGG - Intronic
1005732303 6:28709878-28709900 CTGTGTTCCTGGAGCACAAAAGG - Intergenic
1005909355 6:30294532-30294554 CAGTGTGTCTGGAGTACATGGGG + Intergenic
1006211163 6:32396201-32396223 CCATGTGGCTGGAGAGCAGATGG - Exonic
1006448710 6:34093608-34093630 CTGTGTGGCTGGAGCAGAGCAGG + Intronic
1006728169 6:36215028-36215050 CAGTTTGGCTGCAGCAGAGGGGG + Intronic
1007077615 6:39078061-39078083 CAGTGTGCCTGGCACACAGGAGG + Intronic
1007317549 6:41001573-41001595 CCCTGTGGCTGAAGCAAAGAGGG - Intergenic
1007621860 6:43220403-43220425 CAGTGTGGGAGCAGCACAGGGGG - Intronic
1008837225 6:55849147-55849169 CAGTGTGCCTGAAACACAGAAGG - Intronic
1010598729 6:77797745-77797767 CAGTGTGGCTAGAACAAAGCAGG - Intronic
1010842235 6:80659737-80659759 CAGTGTGGCTGGGGCCAGGAGGG + Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1011380826 6:86740518-86740540 CAATGTGGCTGGAACAAAGCAGG - Intergenic
1012355582 6:98310045-98310067 CAGTGTGTCTGGAGCAAAAGGGG - Intergenic
1012952385 6:105532263-105532285 CAATTTGGCTGGAGCTCAGAGGG + Intergenic
1013033218 6:106356411-106356433 CAGTGATGCTGGAGAAGAGAGGG - Intergenic
1013396531 6:109746548-109746570 CCCTGTGGCTGGGGCCCAGAGGG + Intronic
1013469577 6:110449925-110449947 CAGTGTGGCAGAAGTAGAGAAGG - Intronic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1014007870 6:116442202-116442224 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
1015092620 6:129376590-129376612 CAGTATGGCTGGAGTGCAGATGG - Intronic
1015425040 6:133055597-133055619 CAGCGTGCCAGGAGCAAAGAGGG + Intergenic
1015563374 6:134540322-134540344 CAGTGAGTCTGGAGCCTAGAAGG + Intergenic
1016873781 6:148844557-148844579 CTGAGTGGCTGGAGCAGACAGGG - Intronic
1016912659 6:149214570-149214592 CAGTGTGACTGGAGCACAGAGGG - Intergenic
1017112039 6:150941260-150941282 CAGGGTGGCTGGAGCCCCGTGGG + Intronic
1017988887 6:159469334-159469356 CAGTGGGGCTGATGCACAGATGG - Intergenic
1018098835 6:160418191-160418213 CAGTGTGGCTTGAACAAAGCAGG + Intronic
1018725532 6:166610252-166610274 CAGCCTGGCAGTAGCACAGAAGG + Intronic
1018940959 6:168308633-168308655 CAGGGTGGCTGGAGTACAGACGG - Exonic
1019744659 7:2692870-2692892 CAGTGTGGCTGGAACAAATTGGG - Intronic
1020112593 7:5455961-5455983 CACTGGGGAAGGAGCACAGAGGG - Intronic
1020147932 7:5659461-5659483 CAGTATGGCTGGAGCCCAGTGGG + Intronic
1020210252 7:6153753-6153775 CAGTGCACCTGGAGCAGAGAGGG + Exonic
1020627274 7:10596912-10596934 CAGTATGGCTGGGGCAGAGCCGG + Intergenic
1021611447 7:22461549-22461571 CACTGTGGCTGGCCCACGGAAGG + Intronic
1021851615 7:24814212-24814234 CAGTGTGGCCAGAGGACAGTGGG + Intronic
1021922896 7:25504674-25504696 CAAAGTAGCTGGTGCACAGAAGG - Intergenic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1023852411 7:44157804-44157826 CACTGAGGCTGGAGCAGAGGCGG + Intronic
1025703748 7:63843917-63843939 CACCGAGGCTGGAGCACAGTGGG - Intergenic
1026511528 7:71031443-71031465 TAGTGTGGCTGGGACACAGTGGG - Intergenic
1026814692 7:73501379-73501401 CAGTGTGGTTGGACTACAGAAGG - Intronic
1026902122 7:74043182-74043204 CCCTGGGGCTGGAGGACAGAGGG + Intronic
1027162967 7:75815570-75815592 CACTGAGGTTGGAGGACAGAAGG + Intronic
1027309341 7:76937867-76937889 CTGCGTGGCTGGAGCAGAGTAGG - Intergenic
1028615846 7:92766000-92766022 CACTGTGGCTGGAGAACCGTGGG + Intronic
1029210940 7:98907922-98907944 CAGTGTGGCTGCAGCACATCAGG - Intronic
1029434722 7:100556567-100556589 CAGTGAGGGTGGAGAAGAGAAGG - Intronic
1029482800 7:100823366-100823388 CAGTGTGGCTGGAGCACAGTGGG + Intronic
1029534196 7:101146233-101146255 AAGTCTGGCAGGTGCACAGATGG + Intergenic
1029619989 7:101684407-101684429 ATGACTGGCTGGAGCACAGAGGG + Intergenic
1029793957 7:102874652-102874674 GAGTATGGCTTGAGCCCAGAAGG - Intronic
1029796098 7:102896082-102896104 CAGAGTGGCTGGAGTAGAGTTGG + Intronic
1029905864 7:104093021-104093043 CAGTGGGGCTGGAGGAGACAAGG + Intergenic
1029959554 7:104675298-104675320 CAGAGAGGCTGGAGCAGAGTGGG + Intronic
1030028293 7:105346384-105346406 CATGGTGACTGGAACACAGAGGG + Intronic
1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG + Intronic
1030318501 7:108140691-108140713 CAATGTGGCTAGAGCAGAGTGGG + Intergenic
1030968004 7:116017635-116017657 CAGTATGGCTAGACCACAGTAGG - Intronic
1032446334 7:131986938-131986960 TGGTGTGGCTGGAGTACAGCGGG + Intergenic
1034037093 7:147836349-147836371 CAGTGTGGCTGGAATACTGGGGG - Intronic
1035238544 7:157515742-157515764 CAGGGTGGGTGGAACACAGGAGG - Intergenic
1035448255 7:158957619-158957641 CCGTGTGGCTGCAGCCCAGCTGG - Intergenic
1035599777 8:890801-890823 CAGGGTGGCTTGGGCACAGAGGG - Intergenic
1036020951 8:4845636-4845658 CAGTGTTGAAGAAGCACAGACGG + Intronic
1036306373 8:7605639-7605661 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036357219 8:8053624-8053646 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036706694 8:11052105-11052127 CAGTTTGGTTGGAGCAGAGGGGG - Intronic
1036901350 8:12671629-12671651 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1037162867 8:15793937-15793959 CAGTGTGGCTAGAGCAAAGTGGG + Intergenic
1037527710 8:19742942-19742964 CAGTGTTTCTGCACCACAGAAGG - Intronic
1037620348 8:20558160-20558182 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
1037921379 8:22808552-22808574 GAGTGTGGCAGCAGCACAGCGGG + Intronic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1039892285 8:41693835-41693857 CAGTGCGTCTGGAACACAGTAGG - Intronic
1040055629 8:43055123-43055145 CAGGGTGGTTGGGGCACAGTGGG + Intronic
1041618325 8:59934433-59934455 CAGTGTGGCAGGAGCATAGTTGG + Intergenic
1041677578 8:60550901-60550923 CAATGTGGCTAAAGCACAGGAGG - Intronic
1041914391 8:63125445-63125467 CAGTAGGGGTAGAGCACAGAGGG - Intergenic
1042318785 8:67452905-67452927 CAATGTGGCTGGAGCCAAGTGGG + Intronic
1042339202 8:67661311-67661333 CATTGTGGCTGGAGTAGAGTAGG + Intronic
1042435361 8:68758062-68758084 CAGTGTGCCTGGCACACAGCAGG - Intronic
1042705709 8:71664134-71664156 CAGTGTGGCTGGAGGAGGGTGGG - Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1044698323 8:94944792-94944814 CAGTGAGACTGAAGCTCAGAAGG - Intronic
1044876515 8:96673067-96673089 TAGAGTGACTGGAGCAGAGAAGG + Intronic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1045959138 8:107946504-107946526 CTGTGGGACTGGGGCACAGAAGG + Intronic
1046970977 8:120223112-120223134 CAGTGTGGCTGGAACCCAAAAGG + Intronic
1047213280 8:122856973-122856995 CAGGGTGGCTGGAGCCGAGAAGG - Intronic
1047488024 8:125350434-125350456 CAGTGTGCCTTGAGCACAGTGGG + Intronic
1047534771 8:125709465-125709487 CAGAGTGCCTGGAGCATAGCAGG - Intergenic
1047668094 8:127114691-127114713 CCATGTGGTTGGAGCACAGAGGG - Intergenic
1048166825 8:132069125-132069147 CAATGTAGCTGCAGCAAAGATGG - Intronic
1048509633 8:135050528-135050550 CTTTGTGGCCTGAGCACAGAAGG + Intergenic
1049196013 8:141316044-141316066 CAGAGTGCCTGGAGCAGAGCAGG - Intergenic
1049199785 8:141334434-141334456 CAGTGGGGCTGGGACAGAGAGGG - Intergenic
1049265938 8:141667961-141667983 GAGTGCGTCTGGAGCACAGATGG + Intergenic
1049414637 8:142489668-142489690 CAGAGTGGTTGGAGCCCAGGTGG - Intronic
1049495189 8:142926916-142926938 GAGAGGGACTGGAGCACAGAAGG - Intergenic
1049713312 8:144077348-144077370 CAGAGTGGCTGTAGAGCAGAGGG + Intergenic
1049743861 8:144254798-144254820 AGGTGTGGCTGGAGCAGAGCAGG - Exonic
1050285299 9:4095702-4095724 CAGTTTAGCTGTAGTACAGATGG - Intronic
1050495012 9:6231349-6231371 TAGTGTGGCTGGAGCAGAGCGGG - Intronic
1050814624 9:9794468-9794490 CAATGTGGCTAGAGCAGAGAAGG + Intronic
1050965428 9:11795584-11795606 CAGTCTGTATGGAGCCCAGAGGG - Intergenic
1050970927 9:11872594-11872616 CTGTGAGCCTGGAGAACAGATGG + Intergenic
1051589791 9:18766062-18766084 AAGTCTGGCTGGAGTACACAGGG + Intronic
1051604570 9:18907204-18907226 CAGTCTGGCTGGTGCCCACAGGG + Intronic
1052560403 9:30077450-30077472 CAGTGTGGCTAGAACAAAGCAGG - Intergenic
1052758180 9:32563380-32563402 CAGGATGGCTGGAGTACAGTGGG + Intronic
1052827484 9:33187549-33187571 CAGTGTGGCTGGCGCAGAGGAGG - Intergenic
1053121891 9:35553699-35553721 AAGTGTGGCTGGAGCACAGTGGG + Intronic
1054895948 9:70311318-70311340 GAGAGTGACTGGAGAACAGATGG + Intronic
1055024338 9:71703318-71703340 CTGTGTGGGTGGGGCACAGAGGG + Intronic
1055249585 9:74286988-74287010 CAATGTGGCTGGAGCAGGGTGGG - Intergenic
1055313712 9:75011828-75011850 CACTGTGGCTGTAGGACTGAGGG - Intronic
1056500422 9:87203281-87203303 CACAGTGGCTGAAGCACAAACGG - Intergenic
1056705974 9:88953098-88953120 CAGAGTGGCTGGTGCATTGAAGG - Intergenic
1057528562 9:95824067-95824089 CATATTGCCTGGAGCACAGAAGG - Intergenic
1057834788 9:98435650-98435672 CAGTGTGGCTGGAATAAAGTGGG - Intronic
1058069906 9:100591387-100591409 CAGTGTGGCTGAGGAACAAAGGG + Intergenic
1058546817 9:106069425-106069447 CAATATGGCTAGACCACAGATGG + Intergenic
1058619767 9:106870715-106870737 CAGCTTGGTTGGAGCACAAAAGG + Intronic
1059745380 9:117195377-117195399 CATTGTGTCTGGAGCATGGAGGG + Intronic
1059770916 9:117424383-117424405 GAGTGAGCATGGAGCACAGATGG + Intergenic
1059953870 9:119495903-119495925 CAGTGAGGCTGGGGGAGAGAGGG + Intronic
1060463666 9:123883000-123883022 CATTGTGGCTGGAGTTCAGTGGG - Intronic
1061006644 9:127931813-127931835 CAGAGTGGCTGGAGTGAAGAGGG + Intergenic
1061393203 9:130329154-130329176 CAGTGGGGCTGGAGCAGAAATGG - Intronic
1061444685 9:130631192-130631214 GAGTGTTGATGGAGGACAGATGG + Intronic
1061656785 9:132098028-132098050 CAGAGTGGCTGGAACACAAGAGG + Intergenic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1061826356 9:133260716-133260738 CACGTTGGCTGGAGCACAGAGGG + Intronic
1061977672 9:134078819-134078841 CAGTTTGCCTGGAGCACGTAAGG + Intergenic
1062184139 9:135207650-135207672 CAGCGTGGCTGGAACAAAGCAGG + Intergenic
1062215798 9:135389211-135389233 CAGGGTGGCTGGAGCTCAGGAGG - Intergenic
1185666291 X:1767924-1767946 CAGAGTGACTGCAGCCCAGAGGG + Intergenic
1185703473 X:2249038-2249060 CAGTGTGATAGGAGAACAGATGG - Intronic
1186470735 X:9820313-9820335 GGCTGTGGCTGGAGCAAAGAGGG - Intronic
1186496763 X:10016689-10016711 CATTCTGGCTGCAGTACAGAAGG - Intronic
1186689557 X:11960668-11960690 CAGAGTGGATGGTGCACACAAGG - Intergenic
1187128748 X:16480608-16480630 CAATGTGGCTGGAGCATTTATGG + Intergenic
1187619448 X:21034424-21034446 CAGTGTGGCTGAAGTCCAGAAGG + Intergenic
1188009009 X:25038626-25038648 CAGGATGGCTGGTGCTCAGAAGG + Intergenic
1188147403 X:26630537-26630559 CAGTTTGCATGGAGCCCAGAGGG - Intergenic
1189244671 X:39554336-39554358 TAGTGTGGCTGGAGCAGAGCGGG + Intergenic
1189940733 X:46117899-46117921 CAGTGGCTGTGGAGCACAGAGGG - Intergenic
1190700693 X:52987396-52987418 CAGGATGGCTTGAGCCCAGAAGG + Intronic
1191210457 X:57879334-57879356 CAGTGTTGCTGAAGTTCAGATGG - Intergenic
1192140539 X:68644147-68644169 CAGCGTAGCTGGAACCCAGAGGG - Intergenic
1194023317 X:88721200-88721222 CAGTGTGGCTAGAACAAAGCAGG - Intergenic
1194158315 X:90420166-90420188 CAAGGTGGTTGGAGCACAGCTGG + Intergenic
1194243526 X:91480675-91480697 CAGACTGTCTGGAGCCCAGATGG - Intergenic
1194429401 X:93782421-93782443 CAGTGTGACTGGAGCATAAAGGG + Intergenic
1195941207 X:110169394-110169416 CAGTGAGGCTGGAGGAGAGTGGG - Intronic
1196370867 X:114978336-114978358 CAGTGTGGCTGAAAGACAGATGG + Intergenic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1197652087 X:129076271-129076293 CTGTTTTGCTGCAGCACAGAGGG + Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1197878969 X:131144407-131144429 CAGTGAGGATAGAGAACAGATGG - Intergenic
1198018591 X:132636005-132636027 CAGGGCGTCTGGAGCAGAGAAGG - Intronic
1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG + Intergenic
1199828797 X:151528253-151528275 CAGTGTGTCTGGGGCAGAGAGGG + Intergenic
1200051263 X:153433096-153433118 CTGTGTGGCTGGAGGCCAGTGGG + Intergenic
1200504640 Y:3997130-3997152 CAAGGTGGTTGGAGCACAGCTGG + Intergenic
1200562507 Y:4722050-4722072 CAGACTGTCTGGAGCCCAGATGG - Intergenic
1200688588 Y:6281128-6281150 CAGGGTGACTGGAGCATAGCTGG + Intergenic
1201046685 Y:9893560-9893582 CAGGGTGACTGGAGCATAGCTGG - Intergenic