ID: 1037622404

View in Genome Browser
Species Human (GRCh38)
Location 8:20576366-20576388
Sequence GGAACATAGGTGAACCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037622404_1037622412 16 Left 1037622404 8:20576366-20576388 CCTTCCAGGTTCACCTATGTTCC No data
Right 1037622412 8:20576405-20576427 GAGACTATGGAGAAGTAGGCAGG No data
1037622404_1037622410 3 Left 1037622404 8:20576366-20576388 CCTTCCAGGTTCACCTATGTTCC No data
Right 1037622410 8:20576392-20576414 GACTTCAAATCATGAGACTATGG No data
1037622404_1037622415 26 Left 1037622404 8:20576366-20576388 CCTTCCAGGTTCACCTATGTTCC No data
Right 1037622415 8:20576415-20576437 AGAAGTAGGCAGGGAGGTTGAGG No data
1037622404_1037622411 12 Left 1037622404 8:20576366-20576388 CCTTCCAGGTTCACCTATGTTCC No data
Right 1037622411 8:20576401-20576423 TCATGAGACTATGGAGAAGTAGG No data
1037622404_1037622414 20 Left 1037622404 8:20576366-20576388 CCTTCCAGGTTCACCTATGTTCC No data
Right 1037622414 8:20576409-20576431 CTATGGAGAAGTAGGCAGGGAGG No data
1037622404_1037622413 17 Left 1037622404 8:20576366-20576388 CCTTCCAGGTTCACCTATGTTCC No data
Right 1037622413 8:20576406-20576428 AGACTATGGAGAAGTAGGCAGGG No data
1037622404_1037622416 27 Left 1037622404 8:20576366-20576388 CCTTCCAGGTTCACCTATGTTCC No data
Right 1037622416 8:20576416-20576438 GAAGTAGGCAGGGAGGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037622404 Original CRISPR GGAACATAGGTGAACCTGGA AGG (reversed) Intergenic
No off target data available for this crispr