ID: 1037622407

View in Genome Browser
Species Human (GRCh38)
Location 8:20576379-20576401
Sequence ATTTGAAGTCCTGGGAACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037622407_1037622413 4 Left 1037622407 8:20576379-20576401 CCTATGTTCCCAGGACTTCAAAT No data
Right 1037622413 8:20576406-20576428 AGACTATGGAGAAGTAGGCAGGG No data
1037622407_1037622411 -1 Left 1037622407 8:20576379-20576401 CCTATGTTCCCAGGACTTCAAAT No data
Right 1037622411 8:20576401-20576423 TCATGAGACTATGGAGAAGTAGG No data
1037622407_1037622416 14 Left 1037622407 8:20576379-20576401 CCTATGTTCCCAGGACTTCAAAT No data
Right 1037622416 8:20576416-20576438 GAAGTAGGCAGGGAGGTTGAGGG No data
1037622407_1037622412 3 Left 1037622407 8:20576379-20576401 CCTATGTTCCCAGGACTTCAAAT No data
Right 1037622412 8:20576405-20576427 GAGACTATGGAGAAGTAGGCAGG No data
1037622407_1037622414 7 Left 1037622407 8:20576379-20576401 CCTATGTTCCCAGGACTTCAAAT No data
Right 1037622414 8:20576409-20576431 CTATGGAGAAGTAGGCAGGGAGG No data
1037622407_1037622415 13 Left 1037622407 8:20576379-20576401 CCTATGTTCCCAGGACTTCAAAT No data
Right 1037622415 8:20576415-20576437 AGAAGTAGGCAGGGAGGTTGAGG No data
1037622407_1037622410 -10 Left 1037622407 8:20576379-20576401 CCTATGTTCCCAGGACTTCAAAT No data
Right 1037622410 8:20576392-20576414 GACTTCAAATCATGAGACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037622407 Original CRISPR ATTTGAAGTCCTGGGAACAT AGG (reversed) Intergenic
No off target data available for this crispr