ID: 1037622412

View in Genome Browser
Species Human (GRCh38)
Location 8:20576405-20576427
Sequence GAGACTATGGAGAAGTAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037622408_1037622412 -5 Left 1037622408 8:20576387-20576409 CCCAGGACTTCAAATCATGAGAC No data
Right 1037622412 8:20576405-20576427 GAGACTATGGAGAAGTAGGCAGG No data
1037622407_1037622412 3 Left 1037622407 8:20576379-20576401 CCTATGTTCCCAGGACTTCAAAT No data
Right 1037622412 8:20576405-20576427 GAGACTATGGAGAAGTAGGCAGG No data
1037622405_1037622412 12 Left 1037622405 8:20576370-20576392 CCAGGTTCACCTATGTTCCCAGG No data
Right 1037622412 8:20576405-20576427 GAGACTATGGAGAAGTAGGCAGG No data
1037622404_1037622412 16 Left 1037622404 8:20576366-20576388 CCTTCCAGGTTCACCTATGTTCC No data
Right 1037622412 8:20576405-20576427 GAGACTATGGAGAAGTAGGCAGG No data
1037622409_1037622412 -6 Left 1037622409 8:20576388-20576410 CCAGGACTTCAAATCATGAGACT No data
Right 1037622412 8:20576405-20576427 GAGACTATGGAGAAGTAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037622412 Original CRISPR GAGACTATGGAGAAGTAGGC AGG Intergenic
No off target data available for this crispr