ID: 1037627023

View in Genome Browser
Species Human (GRCh38)
Location 8:20617241-20617263
Sequence TAGAGTGTAAAGAAGAGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037627023_1037627027 19 Left 1037627023 8:20617241-20617263 CCATGCCTCTTCTTTACACTCTA No data
Right 1037627027 8:20617283-20617305 CTTTCCCCTGTATATCCCAATGG No data
1037627023_1037627025 -8 Left 1037627023 8:20617241-20617263 CCATGCCTCTTCTTTACACTCTA No data
Right 1037627025 8:20617256-20617278 ACACTCTACTTCAACTGATTTGG No data
1037627023_1037627026 -7 Left 1037627023 8:20617241-20617263 CCATGCCTCTTCTTTACACTCTA No data
Right 1037627026 8:20617257-20617279 CACTCTACTTCAACTGATTTGGG No data
1037627023_1037627032 28 Left 1037627023 8:20617241-20617263 CCATGCCTCTTCTTTACACTCTA No data
Right 1037627032 8:20617292-20617314 GTATATCCCAATGGATTGGATGG No data
1037627023_1037627030 24 Left 1037627023 8:20617241-20617263 CCATGCCTCTTCTTTACACTCTA No data
Right 1037627030 8:20617288-20617310 CCCTGTATATCCCAATGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037627023 Original CRISPR TAGAGTGTAAAGAAGAGGCA TGG (reversed) Intergenic
No off target data available for this crispr