ID: 1037627693

View in Genome Browser
Species Human (GRCh38)
Location 8:20622397-20622419
Sequence ATGGCTTAACAAAGGGTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037627693_1037627701 27 Left 1037627693 8:20622397-20622419 CCACCAACCCTTTGTTAAGCCAT No data
Right 1037627701 8:20622447-20622469 CCCATTTCATGTTCTTTGCTTGG No data
1037627693_1037627698 -2 Left 1037627693 8:20622397-20622419 CCACCAACCCTTTGTTAAGCCAT No data
Right 1037627698 8:20622418-20622440 ATGCATGTGTGTCCATGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037627693 Original CRISPR ATGGCTTAACAAAGGGTTGG TGG (reversed) Intergenic
No off target data available for this crispr