ID: 1037629604

View in Genome Browser
Species Human (GRCh38)
Location 8:20642069-20642091
Sequence GTCAAGAAGAGGAAGTCGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037629604_1037629607 0 Left 1037629604 8:20642069-20642091 CCTGTCGACTTCCTCTTCTTGAC No data
Right 1037629607 8:20642092-20642114 TTTCAACCCCTGTGAACAAAGGG No data
1037629604_1037629606 -1 Left 1037629604 8:20642069-20642091 CCTGTCGACTTCCTCTTCTTGAC No data
Right 1037629606 8:20642091-20642113 CTTTCAACCCCTGTGAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037629604 Original CRISPR GTCAAGAAGAGGAAGTCGAC AGG (reversed) Intergenic
No off target data available for this crispr