ID: 1037632275

View in Genome Browser
Species Human (GRCh38)
Location 8:20668994-20669016
Sequence ACATACAAGCAATAGTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037632275_1037632277 4 Left 1037632275 8:20668994-20669016 CCTCCAAACTATTGCTTGTATGT No data
Right 1037632277 8:20669021-20669043 GTGTTTGCATAAATTTATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037632275 Original CRISPR ACATACAAGCAATAGTTTGG AGG (reversed) Intergenic
No off target data available for this crispr