ID: 1037634352

View in Genome Browser
Species Human (GRCh38)
Location 8:20687793-20687815
Sequence TTCCCAAGACCTCTGAAGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037634352_1037634354 -6 Left 1037634352 8:20687793-20687815 CCGGTCTTCAGAGGTCTTGGGAA No data
Right 1037634354 8:20687810-20687832 TGGGAAGATCTGGAATGCCTTGG No data
1037634352_1037634355 -5 Left 1037634352 8:20687793-20687815 CCGGTCTTCAGAGGTCTTGGGAA No data
Right 1037634355 8:20687811-20687833 GGGAAGATCTGGAATGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037634352 Original CRISPR TTCCCAAGACCTCTGAAGAC CGG (reversed) Intergenic
No off target data available for this crispr