ID: 1037639578

View in Genome Browser
Species Human (GRCh38)
Location 8:20730526-20730548
Sequence GACCCAGGCACTGTTCCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037639578_1037639583 -1 Left 1037639578 8:20730526-20730548 CCAATGGGAACAGTGCCTGGGTC No data
Right 1037639583 8:20730548-20730570 CCACCCTGCAGCTCTTCCAGGGG No data
1037639578_1037639580 -3 Left 1037639578 8:20730526-20730548 CCAATGGGAACAGTGCCTGGGTC No data
Right 1037639580 8:20730546-20730568 GTCCACCCTGCAGCTCTTCCAGG No data
1037639578_1037639587 18 Left 1037639578 8:20730526-20730548 CCAATGGGAACAGTGCCTGGGTC No data
Right 1037639587 8:20730567-20730589 GGGGCAGTTAGAACAGCCTTTGG No data
1037639578_1037639581 -2 Left 1037639578 8:20730526-20730548 CCAATGGGAACAGTGCCTGGGTC No data
Right 1037639581 8:20730547-20730569 TCCACCCTGCAGCTCTTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037639578 Original CRISPR GACCCAGGCACTGTTCCCAT TGG (reversed) Intergenic
No off target data available for this crispr