ID: 1037640623

View in Genome Browser
Species Human (GRCh38)
Location 8:20738992-20739014
Sequence GCTTTCTGTAGAAATACCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037640619_1037640623 22 Left 1037640619 8:20738947-20738969 CCTCCTCCTTTAGTATCTATTAT No data
Right 1037640623 8:20738992-20739014 GCTTTCTGTAGAAATACCTTAGG No data
1037640620_1037640623 19 Left 1037640620 8:20738950-20738972 CCTCCTTTAGTATCTATTATTTT No data
Right 1037640623 8:20738992-20739014 GCTTTCTGTAGAAATACCTTAGG No data
1037640621_1037640623 16 Left 1037640621 8:20738953-20738975 CCTTTAGTATCTATTATTTTTAA No data
Right 1037640623 8:20738992-20739014 GCTTTCTGTAGAAATACCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037640623 Original CRISPR GCTTTCTGTAGAAATACCTT AGG Intergenic
No off target data available for this crispr