ID: 1037643577

View in Genome Browser
Species Human (GRCh38)
Location 8:20770693-20770715
Sequence GATTTCCATTGAAACCGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037643576_1037643577 -8 Left 1037643576 8:20770678-20770700 CCAAAAGCATGGTGAGATTTCCA No data
Right 1037643577 8:20770693-20770715 GATTTCCATTGAAACCGAGCTGG No data
1037643575_1037643577 -7 Left 1037643575 8:20770677-20770699 CCCAAAAGCATGGTGAGATTTCC No data
Right 1037643577 8:20770693-20770715 GATTTCCATTGAAACCGAGCTGG No data
1037643573_1037643577 5 Left 1037643573 8:20770665-20770687 CCACGTTACAAGCCCAAAAGCAT No data
Right 1037643577 8:20770693-20770715 GATTTCCATTGAAACCGAGCTGG No data
1037643572_1037643577 11 Left 1037643572 8:20770659-20770681 CCACTTCCACGTTACAAGCCCAA No data
Right 1037643577 8:20770693-20770715 GATTTCCATTGAAACCGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037643577 Original CRISPR GATTTCCATTGAAACCGAGC TGG Intergenic
No off target data available for this crispr