ID: 1037643662

View in Genome Browser
Species Human (GRCh38)
Location 8:20771157-20771179
Sequence TGGCCCTCCTTTGCAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037643650_1037643662 21 Left 1037643650 8:20771113-20771135 CCCAATCAGCAAAGAGGAATGGG No data
Right 1037643662 8:20771157-20771179 TGGCCCTCCTTTGCAGTGGGTGG No data
1037643648_1037643662 22 Left 1037643648 8:20771112-20771134 CCCCAATCAGCAAAGAGGAATGG No data
Right 1037643662 8:20771157-20771179 TGGCCCTCCTTTGCAGTGGGTGG No data
1037643655_1037643662 -9 Left 1037643655 8:20771143-20771165 CCACCCAGCCCAGGTGGCCCTCC No data
Right 1037643662 8:20771157-20771179 TGGCCCTCCTTTGCAGTGGGTGG No data
1037643652_1037643662 20 Left 1037643652 8:20771114-20771136 CCAATCAGCAAAGAGGAATGGGA No data
Right 1037643662 8:20771157-20771179 TGGCCCTCCTTTGCAGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037643662 Original CRISPR TGGCCCTCCTTTGCAGTGGG TGG Intergenic
No off target data available for this crispr