ID: 1037645322 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:20787596-20787618 |
| Sequence | ATGGTGTGCTTGATGATACA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1037645318_1037645322 | 3 | Left | 1037645318 | 8:20787570-20787592 | CCACTTTCTATAGGCCTGTTCTA | No data | ||
| Right | 1037645322 | 8:20787596-20787618 | ATGGTGTGCTTGATGATACAGGG | No data | ||||
| 1037645316_1037645322 | 19 | Left | 1037645316 | 8:20787554-20787576 | CCAGGGTCATACAGAACCACTTT | No data | ||
| Right | 1037645322 | 8:20787596-20787618 | ATGGTGTGCTTGATGATACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1037645322 | Original CRISPR | ATGGTGTGCTTGATGATACA GGG | Intergenic | ||
| No off target data available for this crispr | |||||