ID: 1037645322

View in Genome Browser
Species Human (GRCh38)
Location 8:20787596-20787618
Sequence ATGGTGTGCTTGATGATACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037645318_1037645322 3 Left 1037645318 8:20787570-20787592 CCACTTTCTATAGGCCTGTTCTA No data
Right 1037645322 8:20787596-20787618 ATGGTGTGCTTGATGATACAGGG No data
1037645316_1037645322 19 Left 1037645316 8:20787554-20787576 CCAGGGTCATACAGAACCACTTT No data
Right 1037645322 8:20787596-20787618 ATGGTGTGCTTGATGATACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037645322 Original CRISPR ATGGTGTGCTTGATGATACA GGG Intergenic
No off target data available for this crispr