ID: 1037645669

View in Genome Browser
Species Human (GRCh38)
Location 8:20790623-20790645
Sequence AGGGAGAAATAATATGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037645669_1037645677 25 Left 1037645669 8:20790623-20790645 CCTCCTTCATATTATTTCTCCCT No data
Right 1037645677 8:20790671-20790693 GGTCTTCTTTCTAGTTCCCTAGG No data
1037645669_1037645673 4 Left 1037645669 8:20790623-20790645 CCTCCTTCATATTATTTCTCCCT No data
Right 1037645673 8:20790650-20790672 TCTTGTCCTCAAACCTATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037645669 Original CRISPR AGGGAGAAATAATATGAAGG AGG (reversed) Intergenic
No off target data available for this crispr