ID: 1037648693

View in Genome Browser
Species Human (GRCh38)
Location 8:20817066-20817088
Sequence TGACCAGCAGCAGTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037648685_1037648693 23 Left 1037648685 8:20817020-20817042 CCTGACGGATCCGGAGGGATGGA No data
Right 1037648693 8:20817066-20817088 TGACCAGCAGCAGTGGTGGATGG No data
1037648687_1037648693 13 Left 1037648687 8:20817030-20817052 CCGGAGGGATGGATGTCAGTGGC No data
Right 1037648693 8:20817066-20817088 TGACCAGCAGCAGTGGTGGATGG No data
1037648683_1037648693 24 Left 1037648683 8:20817019-20817041 CCCTGACGGATCCGGAGGGATGG No data
Right 1037648693 8:20817066-20817088 TGACCAGCAGCAGTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037648693 Original CRISPR TGACCAGCAGCAGTGGTGGA TGG Intergenic
No off target data available for this crispr