ID: 1037649809

View in Genome Browser
Species Human (GRCh38)
Location 8:20826051-20826073
Sequence TAGGATAACCAGAATGTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037649809_1037649812 5 Left 1037649809 8:20826051-20826073 CCCACAACATTCTGGTTATCCTA No data
Right 1037649812 8:20826079-20826101 TGAAAGCTCCAGAGCCTATGAGG No data
1037649809_1037649813 12 Left 1037649809 8:20826051-20826073 CCCACAACATTCTGGTTATCCTA No data
Right 1037649813 8:20826086-20826108 TCCAGAGCCTATGAGGCCCAAGG No data
1037649809_1037649815 15 Left 1037649809 8:20826051-20826073 CCCACAACATTCTGGTTATCCTA No data
Right 1037649815 8:20826089-20826111 AGAGCCTATGAGGCCCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037649809 Original CRISPR TAGGATAACCAGAATGTTGT GGG (reversed) Intergenic
No off target data available for this crispr