ID: 1037650315

View in Genome Browser
Species Human (GRCh38)
Location 8:20831513-20831535
Sequence GTGCAAACCCATAATAATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037650315_1037650316 10 Left 1037650315 8:20831513-20831535 CCATGATTATTATGGGTTTGCAC No data
Right 1037650316 8:20831546-20831568 CATCTTGATTCAGCTCATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037650315 Original CRISPR GTGCAAACCCATAATAATCA TGG (reversed) Intergenic
No off target data available for this crispr