ID: 1037650479

View in Genome Browser
Species Human (GRCh38)
Location 8:20833618-20833640
Sequence TTGGTGGTCCAAACATATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037650479_1037650482 3 Left 1037650479 8:20833618-20833640 CCATGATATGTTTGGACCACCAA No data
Right 1037650482 8:20833644-20833666 TCTTCAGAAGTTGATAGAGCAGG No data
1037650479_1037650483 6 Left 1037650479 8:20833618-20833640 CCATGATATGTTTGGACCACCAA No data
Right 1037650483 8:20833647-20833669 TCAGAAGTTGATAGAGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037650479 Original CRISPR TTGGTGGTCCAAACATATCA TGG (reversed) Intergenic
No off target data available for this crispr