ID: 1037650962

View in Genome Browser
Species Human (GRCh38)
Location 8:20838205-20838227
Sequence GGACATAAAAATTATGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037650954_1037650962 23 Left 1037650954 8:20838159-20838181 CCATTAACTTCGTGATAACATTC No data
Right 1037650962 8:20838205-20838227 GGACATAAAAATTATGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037650962 Original CRISPR GGACATAAAAATTATGAGCT AGG Intergenic
No off target data available for this crispr