ID: 1037652545

View in Genome Browser
Species Human (GRCh38)
Location 8:20852044-20852066
Sequence GTGTACACCCTTATTTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037652544_1037652545 10 Left 1037652544 8:20852011-20852033 CCTGTGAAATTTTAACATGAAAT No data
Right 1037652545 8:20852044-20852066 GTGTACACCCTTATTTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037652545 Original CRISPR GTGTACACCCTTATTTCTCC AGG Intergenic
No off target data available for this crispr