ID: 1037653917

View in Genome Browser
Species Human (GRCh38)
Location 8:20866725-20866747
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037653917_1037653921 27 Left 1037653917 8:20866725-20866747 CCTCTCCAGGGCTGTCTTCAGGG No data
Right 1037653921 8:20866775-20866797 AGTACTGTAGGTGAAAAGCTTGG No data
1037653917_1037653920 15 Left 1037653917 8:20866725-20866747 CCTCTCCAGGGCTGTCTTCAGGG No data
Right 1037653920 8:20866763-20866785 CACTTGAAAGCAAGTACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037653917 Original CRISPR CCCTGAAGACAGCCCTGGAG AGG (reversed) Intergenic
No off target data available for this crispr