ID: 1037655209

View in Genome Browser
Species Human (GRCh38)
Location 8:20877191-20877213
Sequence TGGTACCAGCAGAAGCAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037655209_1037655212 -9 Left 1037655209 8:20877191-20877213 CCCTTCTGCTTCTGCTGGTACCA No data
Right 1037655212 8:20877205-20877227 CTGGTACCACTCCTGGAAGCAGG No data
1037655209_1037655215 13 Left 1037655209 8:20877191-20877213 CCCTTCTGCTTCTGCTGGTACCA No data
Right 1037655215 8:20877227-20877249 GAAAGCAGCATCAAGAATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037655209 Original CRISPR TGGTACCAGCAGAAGCAGAA GGG (reversed) Intergenic
No off target data available for this crispr