ID: 1037656366

View in Genome Browser
Species Human (GRCh38)
Location 8:20887653-20887675
Sequence AGGTCCCTTCTCAGGGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037656366_1037656370 -5 Left 1037656366 8:20887653-20887675 CCATGTCCCCTGAGAAGGGACCT No data
Right 1037656370 8:20887671-20887693 GACCTTTGTCTCCTGACTTCTGG No data
1037656366_1037656371 -4 Left 1037656366 8:20887653-20887675 CCATGTCCCCTGAGAAGGGACCT No data
Right 1037656371 8:20887672-20887694 ACCTTTGTCTCCTGACTTCTGGG No data
1037656366_1037656374 20 Left 1037656366 8:20887653-20887675 CCATGTCCCCTGAGAAGGGACCT No data
Right 1037656374 8:20887696-20887718 CAGTGTTTTTTCATTATTCTAGG No data
1037656366_1037656375 21 Left 1037656366 8:20887653-20887675 CCATGTCCCCTGAGAAGGGACCT No data
Right 1037656375 8:20887697-20887719 AGTGTTTTTTCATTATTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037656366 Original CRISPR AGGTCCCTTCTCAGGGGACA TGG (reversed) Intergenic
No off target data available for this crispr