ID: 1037658355

View in Genome Browser
Species Human (GRCh38)
Location 8:20906522-20906544
Sequence TATTAGATGCAGGCATTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037658351_1037658355 22 Left 1037658351 8:20906477-20906499 CCAGGAACAGATAAATTCATCAA No data
Right 1037658355 8:20906522-20906544 TATTAGATGCAGGCATTGGAGGG No data
1037658350_1037658355 23 Left 1037658350 8:20906476-20906498 CCCAGGAACAGATAAATTCATCA No data
Right 1037658355 8:20906522-20906544 TATTAGATGCAGGCATTGGAGGG No data
1037658349_1037658355 24 Left 1037658349 8:20906475-20906497 CCCCAGGAACAGATAAATTCATC No data
Right 1037658355 8:20906522-20906544 TATTAGATGCAGGCATTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037658355 Original CRISPR TATTAGATGCAGGCATTGGA GGG Intergenic
No off target data available for this crispr