ID: 1037658651

View in Genome Browser
Species Human (GRCh38)
Location 8:20908539-20908561
Sequence GTGGGAGCACAAGTATTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037658641_1037658651 25 Left 1037658641 8:20908491-20908513 CCACAGAATGTAGGCCCAGGGAG No data
Right 1037658651 8:20908539-20908561 GTGGGAGCACAAGTATTTGGTGG No data
1037658645_1037658651 10 Left 1037658645 8:20908506-20908528 CCAGGGAGCACCTCACCTGGGCA No data
Right 1037658651 8:20908539-20908561 GTGGGAGCACAAGTATTTGGTGG No data
1037658646_1037658651 0 Left 1037658646 8:20908516-20908538 CCTCACCTGGGCAGCAGTGCAGT No data
Right 1037658651 8:20908539-20908561 GTGGGAGCACAAGTATTTGGTGG No data
1037658648_1037658651 -5 Left 1037658648 8:20908521-20908543 CCTGGGCAGCAGTGCAGTGTGGG No data
Right 1037658651 8:20908539-20908561 GTGGGAGCACAAGTATTTGGTGG No data
1037658644_1037658651 11 Left 1037658644 8:20908505-20908527 CCCAGGGAGCACCTCACCTGGGC No data
Right 1037658651 8:20908539-20908561 GTGGGAGCACAAGTATTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037658651 Original CRISPR GTGGGAGCACAAGTATTTGG TGG Intergenic
No off target data available for this crispr