ID: 1037659783

View in Genome Browser
Species Human (GRCh38)
Location 8:20916616-20916638
Sequence CAGTGGGTATGGGGGGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037659768_1037659783 28 Left 1037659768 8:20916565-20916587 CCCTGTTTATTCCTGGGGTAAAA No data
Right 1037659783 8:20916616-20916638 CAGTGGGTATGGGGGGAAACTGG No data
1037659769_1037659783 27 Left 1037659769 8:20916566-20916588 CCTGTTTATTCCTGGGGTAAAAG No data
Right 1037659783 8:20916616-20916638 CAGTGGGTATGGGGGGAAACTGG No data
1037659772_1037659783 17 Left 1037659772 8:20916576-20916598 CCTGGGGTAAAAGGAGGTTTGAA No data
Right 1037659783 8:20916616-20916638 CAGTGGGTATGGGGGGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037659783 Original CRISPR CAGTGGGTATGGGGGGAAAC TGG Intergenic
No off target data available for this crispr